Result : EXP00099
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00099 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4287441 |
| Right | 4287491 |
| Strand | + |
| Nucleotide Sequence | TTGTTTAGTATTTGGGCGACAGATCACGCAAAAGTAGAATTGTGCAAATAA |
| Sequence | LFSIWATDHAKVELCK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5140717 | 5140767 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4287441 | 4287491 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3395695 | 3395745 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4515758 | 4515808 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 5 | 2265128 | 2265178 | + | NZ_CP053416.1 | Salmonella bongori |
| 6 | 4298030 | 4298080 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 7 | 4315782 | 4315832 | + | NZ_AP014857.1 | Escherichia albertii |
| 8 | 3543064 | 3543114 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 9 | 3649533 | 3649583 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00474.19 | 1.0 | 8 | 2540 | opposite-strand | Sodium:solute symporter family |
| 2 | PF04341.14 | 1.0 | 8 | 2229 | opposite-strand | Protein of unknown function, DUF485 |
| 3 | PF00501.30 | 0.88 | 7 | 70.0 | opposite-strand | AMP-binding enzyme |
| 4 | PF13193.8 | 1.0 | 8 | 70 | opposite-strand | AMP-binding enzyme C-terminal domain |
| 5 | PF16177.7 | 1.0 | 8 | 70 | opposite-strand | Acetyl-coenzyme A synthetase N-terminus |
| 6 | PF02335.17 | 0.88 | 7 | 273.0 | same-strand | Cytochrome c552 |
| 7 | PF09699.12 | 0.88 | 7 | 1755.0 | same-strand | Doubled CXXCH motif (Paired CXXCH 1) |
| 8 | PF14537.8 | 0.88 | 7 | 1755.0 | same-strand | Cytochrome c3 |
| 9 | PF13247.8 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S dicluster domain |
| 10 | PF12838.9 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S dicluster domain |
| 11 | PF00037.29 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S binding domain |
| 12 | PF13187.8 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S dicluster domain |
| 13 | PF12837.9 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S binding domain |
| 14 | PF13237.8 | 0.88 | 7 | 2318.0 | same-strand | 4Fe-4S dicluster domain |
| 15 | PF03916.16 | 0.88 | 7 | 2986.0 | same-strand | Polysulphide reductase, NrfD |
| 16 | PF01578.22 | 0.88 | 7 | 4057.0 | same-strand | Cytochrome C assembly protein |
++ More..