Result : EXP00097
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00097 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6868993 |
| Right | 6869085 |
| Strand | - |
| Nucleotide Sequence | ATGGGGTGGGACTGCTGGAGGACGCCATGGTCACCGAAGTGCGACCCGACGCCGTGGTGCTCGACGACGGCACGGTGTGGCGCAGCGACCTGA |
| Sequence | MGWDCWRTPWSPKCDPTPWCSTTARCGAAT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6862554 | 6862646 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1553543 | 1553629 | - | NZ_CP062804.1 | Cupriavidus basilensis |
| 3 | 3489636 | 3489728 | + | NZ_AP012547.1 | Sulfuritalea hydrogenivorans sk43H |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08281.14 | 0.67 | 2 | 2352.5 | same-strand | Sigma-70, region 4 |
| 2 | PF04542.16 | 0.67 | 2 | 2352.5 | same-strand | Sigma-70 region 2 |
| 3 | PF00294.26 | 0.67 | 2 | 1602.5 | both-strands | pfkB family carbohydrate kinase |
++ More..