Result : EXP00094
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00094 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6311376 |
| Right | 6311441 |
| Strand | - |
| Nucleotide Sequence | ATGTCGAGCCCTGAGGCATCCAAGGTGGGGGCTTTCGGTCACGCCGTCAGCCCCCTGAATCACTGA |
| Sequence | MSSPEASKVGAFGHAVSPLNH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 31
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6311307 | 6311372 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 8768769 | 8768834 | - | NZ_CP010407.1 | Streptomyces vietnamensis |
| 3 | 1335294 | 1335359 | - | NZ_CP031455.1 | Streptomyces olivoreticuli subsp. olivoreticuli |
| 4 | 122399 | 122464 | + | NZ_CP051006.1 | Streptomyces griseofuscus |
| 5 | 5111353 | 5111418 | - | NZ_CP031264.1 | Streptacidiphilus bronchialis |
| 6 | 5338576 | 5338641 | - | NZ_CP016279.1 | Streptomyces griseochromogenes |
| 7 | 5819679 | 5819744 | - | NZ_CP032229.1 | Streptomyces seoulensis |
| 8 | 293713 | 293784 | - | NZ_CP022310.1 | Streptomyces calvus |
| 9 | 6114773 | 6114838 | - | NC_013947.1 | Stackebrandtia nassauensis DSM 44728 |
| 10 | 265439 | 265504 | + | NZ_CP023407.1 | Streptomyces fungicidicus |
| 11 | 7877217 | 7877282 | + | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 12 | 1319373 | 1319438 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 13 | 5935956 | 5936021 | - | NZ_CP015866.1 | Streptomyces parvulus |
| 14 | 7936788 | 7936844 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
| 15 | 285956 | 286021 | + | NZ_CP072827.1 | Streptomyces mobaraensis NBRC 13819 = DSM 40847 |
| 16 | 4999943 | 4999999 | - | NZ_AP022870.1 | Phytohabitans flavus |
| 17 | 1056498 | 1056563 | - | NZ_LS483459.1 | Corynebacterium jeikeium |
| 18 | 86334 | 86399 | - | NZ_CP056080.1 | Rothia nasimurium |
| 19 | 67850 | 67915 | - | NZ_CP056080.1 | Rothia nasimurium |
| 20 | 2193 | 2258 | - | NZ_CP018045.1 | Bifidobacterium choerinum |
| 21 | 3280734 | 3280799 | - | NZ_CP034412.1 | Glutamicibacter creatinolyticus |
| 22 | 411431 | 411496 | + | NZ_CP010827.1 | Corynebacterium singulare |
| 23 | 1909471 | 1909536 | + | NZ_CP018135.1 | Neomicrococcus aestuarii |
| 24 | 1916433 | 1916498 | + | NZ_CP018135.1 | Neomicrococcus aestuarii |
| 25 | 244435 | 244500 | - | NZ_LT906467.1 | Corynebacterium imitans |
| 26 | 1108300 | 1108365 | - | NZ_LT906481.1 | Corynebacterium urealyticum |
| 27 | 199105 | 199170 | - | NZ_LT906481.1 | Corynebacterium urealyticum |
| 28 | 105639 | 105704 | + | NZ_CP033082.1 | Glutamicibacter nicotianae |
| 29 | 1018982 | 1019047 | + | NZ_CP068161.1 | Corynebacterium propinquum |
| 30 | 4779619 | 4779675 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 31 | 2447426 | 2447491 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 32 | 326253 | 326318 | + | NZ_CP038266.1 | Microbacterium wangchenii |
| 33 | 4010688 | 4010753 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 34 | 99759 | 99824 | - | NZ_CP042260.1 | Glutamicibacter halophytocola |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 0.87 | 27 | 104 | same-strand | Major Facilitator Superfamily |
| 2 | PF06779.16 | 0.94 | 29 | 104.0 | same-strand | Uncharacterised MFS-type transporter YbfB |
++ More..