Result : EXP00089
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00089 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5857510 |
| Right | 5857566 |
| Strand | - |
| Nucleotide Sequence | ATGAATCCGGAAGATCACCCGACACCGGCGTCTGTGTTCTCCCGCAGAGATTCCTGA |
| Sequence | MNPEDHPTPASVFSRRDS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2499035 | 2499091 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 5875604 | 5875660 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07210.14 | 1.0 | 2 | 2930.5 | opposite-strand | Protein of unknown function (DUF1416) |
| 2 | PF00581.22 | 1.0 | 2 | 2095.5 | opposite-strand | Rhodanese-like domain |
| 3 | PF14340.8 | 1.0 | 2 | 1579.0 | opposite-strand | Domain of unknown function (DUF4395) |
| 4 | PF00085.22 | 1.0 | 2 | 916.0 | opposite-strand | Thioredoxin |
| 5 | PF11209.10 | 1.0 | 2 | 92.0 | opposite-strand | LmeA-like phospholipid-binding |
| 6 | PF00486.30 | 1.0 | 2 | 17.5 | same-strand | Transcriptional regulatory protein, C terminal |
| 7 | PF00583.27 | 1.0 | 2 | 802.5 | same-strand | Acetyltransferase (GNAT) family |
| 8 | PF13508.9 | 1.0 | 2 | 802.5 | same-strand | Acetyltransferase (GNAT) domain |
| 9 | PF12849.9 | 1.0 | 2 | 1846.0 | same-strand | PBP superfamily domain |
| 10 | PF01547.27 | 1.0 | 2 | 1846.0 | same-strand | Bacterial extracellular solute-binding protein |
| 11 | PF00528.24 | 1.0 | 2 | 3542.0 | same-strand | Binding-protein-dependent transport system inner membrane component |
++ More..