Result : EXP00088
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00088 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5769924 |
| Right | 5769986 |
| Strand | - |
| Nucleotide Sequence | GTGTGGGTGACGTCTTCAAGGCCTTGGCCGATCCTACTCGCCGGACGATTCTCGACGAGCTGA |
| Sequence | VWVTSSRPWPILLAGRFSTS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2601085 | 2601147 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 1201668 | 1201724 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
| 3 | 5090662 | 5090715 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00903.27 | 1.0 | 3 | 223.5 | same-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
| 2 | PF18029.3 | 1.0 | 3 | 223.5 | same-strand | Glyoxalase-like domain |
| 3 | PF12840.9 | 1.0 | 3 | -56 | same-strand | Helix-turn-helix domain |
| 4 | PF12802.9 | 1.0 | 3 | -56 | same-strand | MarR family |
| 5 | PF01022.22 | 1.0 | 3 | -56 | same-strand | Bacterial regulatory protein, arsR family |
| 6 | PF13669.8 | 1.0 | 3 | 226 | same-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
++ More..