| Protein name |
EXP00086 |
| NCBI Accession ID |
CP000480.1 |
| Organism |
Mycolicibacterium smegmatis MC2 155 |
| Left |
5372758 |
| Right |
5372802 |
| Strand |
- |
| Nucleotide Sequence |
ATGAAGGCACGGACCGGGATCAAAGGGTGTTGTCGGGCTCAGTAG |
| Sequence |
MKARTGIKGCCRAQ |
| Source of smORF |
Ribo-seq |
| Function |
It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
| Pubmed ID |
26536359
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
14 |