Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00078 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 4621526 |
Right | 4621615 |
Strand | - |
Nucleotide Sequence | ATGCATTCCGCCGGTGCGATGGGGAGCCACGTCGTGGTGCTTCCTGCTGCCGGCTTCTGCGTCGTCGCTGACGCGCACTGTTGTCGCTGA |
Sequence | MHSAGAMGSHVVVLPAAGFCVVADAHCCR |
Source of smORF | Ribo-seq |
Function | It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Manually curated function from literature |
Uniprot ID | |
ORF Length (Amino Acid) | 29 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4621616 | 4621705 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
2 | 3789354 | 3789446 | + | NZ_CP012150.1 | Mycobacterium goodii |
3 | 7755749 | 7755841 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
4 | 3841626 | 3841718 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
5 | 6134102 | 6134194 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
6 | 3596998 | 3597090 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
7 | 1774572 | 1774667 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
8 | 1638028 | 1638123 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
9 | 1526365 | 1526460 | + | NZ_CP010271.1 | Mycobacteroides saopaulense |
10 | 3920080 | 3920172 | - | NZ_LR134356.1 | Mycolicibacterium aurum |
11 | 1508055 | 1508147 | - | NZ_AP022569.1 | Mycobacterium cookii |
12 | 2545732 | 2545824 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
13 | 2004656 | 2004748 | + | NZ_AP024310.1 | Mycobacterium heckeshornense |
14 | 4146614 | 4146706 | - | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
15 | 5799803 | 5799895 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
16 | 823492 | 823584 | + | NZ_AP022586.1 | Mycolicibacterium litorale |
17 | 4041798 | 4041890 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
18 | 1693321 | 1693413 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
19 | 146557 | 146649 | - | NZ_AP022583.1 | Mycobacterium noviomagense |
20 | 4834392 | 4834484 | - | NZ_CP043474.1 | Mycobacterium grossiae |
21 | 2752600 | 2752692 | + | NZ_AP022560.1 | Mycolicibacterium moriokaense |
22 | 1136675 | 1136767 | + | NZ_AP022617.1 | Mycolicibacterium monacense |
23 | 2965655 | 2965747 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00005.29 | 1.0 | 23 | 2865 | same-strand | ABC transporter |
2 | PF12857.9 | 1.0 | 23 | 2863.5 | same-strand | TOBE-like domain |
3 | PF08402.12 | 0.83 | 19 | 2870 | same-strand | TOBE domain |
4 | PF00528.24 | 1.0 | 23 | 1967 | same-strand | Binding-protein-dependent transport system inner membrane component |
5 | PF13531.8 | 1.0 | 23 | 120 | same-strand | Bacterial extracellular solute-binding protein |
6 | PF13416.8 | 0.96 | 22 | 119.5 | same-strand | Bacterial extracellular solute-binding protein |
7 | PF01547.27 | 0.91 | 21 | 120 | same-strand | Bacterial extracellular solute-binding protein |
8 | PF13401.8 | 0.7 | 16 | 2866.0 | same-strand | AAA domain |