Protein Information |
Information Type | Description |
---|---|
Protein name | 30S ribosomal protein S18 |
NCBI Accession ID | CP000786.1 |
Organism | Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) |
Left | 2193517 |
Right | 2193801 |
Strand | - |
Nucleotide Sequence | ATGGAAGACGACGAAAAAGGTGGTTTCCGTGGTAAAGACGGAGAAGGTAAGTTCGGTCGTAAAAACGCAAAATACAAAAAGAAAGTATGTAAGTTCTGTGCTGACAAAGCCTTACTTGCAGGTCTTGATTACAAACGAGTTGATATCTTAGAAAGATTTGTGACCAATCGTGGTAAAATCATTCCAAGAAGGATCACAGGAACTTGTGGCAAACACCAAAGAGCCCTTGCTCGTGAAATCAGAAAATCCAGATCCATCGGTTTACTACCGTTTAAAGTTCTGTAG |
Sequence | MEDDEKGGFRGKDGEGKFGRKNAKYKKKVCKFCADKALLAGLDYKRVDILERFVTNRGKIIPRRITGTCGKHQRALAREIRKSRSIGLLPFKVL |
Source of smORF | Swiss-Prot |
Function | Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_00270}. |
Pubmed ID | 18270594 |
Domain | CDD:412341 |
Functional Category | Ribosomal_protein |
Uniprot ID | B0SSW0 |
ORF Length (Amino Acid) | 94 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 562875 | 563120 | - | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
2 | 3866599 | 3866844 | + | NZ_CP033614.1 | Leptospira kmetyi |
3 | 2803323 | 2803568 | - | NZ_CP040840.1 | Leptospira weilii |
4 | 2509595 | 2509840 | - | NZ_CP026671.1 | Leptospira borgpetersenii serovar Ceylonica |
5 | 3287525 | 3287770 | - | NZ_CP030142.1 | Leptospira mayottensis |
6 | 1604132 | 1604377 | + | NZ_CP015217.1 | Leptospira tipperaryensis |
7 | 1141767 | 1142078 | + | NZ_CP031518.1 | Treponema ruminis |
8 | 1615919 | 1616203 | - | NC_015732.1 | Treponema caldarium DSM 7334 |
9 | 3435564 | 3435833 | + | NZ_CP035807.1 | Thiospirochaeta perfilievii |
10 | 69847 | 70146 | - | NC_015714.1 | Treponema paraluiscuniculi Cuniculi A |
11 | 2240202 | 2240459 | + | NZ_CP009228.1 | Treponema putidum |
12 | 1686398 | 1686649 | - | NC_015500.1 | Treponema brennaborense DSM 12168 |
13 | 1363780 | 1364046 | - | NZ_CP054142.1 | Treponema parvum |
14 | 2795367 | 2795606 | - | NZ_CP016757.1 | Cloacibacillus porcorum |
15 | 3790018 | 3790284 | - | NZ_CP040924.1 | Clostridium thermarum |
16 | 3074961 | 3075272 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
17 | 2855016 | 2855261 | - | NZ_CP016786.1 | Clostridium isatidis |
18 | 1711118 | 1711351 | - | NZ_CP023671.1 | Clostridium septicum |
19 | 65010 | 65303 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
20 | 90250 | 90540 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
21 | 5924001 | 5924261 | - | NZ_CP043998.1 | Clostridium diolis |
22 | 2805029 | 2805283 | - | NZ_CP032416.1 | Clostridium fermenticellae |
23 | 1001929 | 1002159 | - | NZ_CP048000.1 | Anaerocolumna sedimenticola |
24 | 132171 | 132464 | + | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
25 | 3240554 | 3240796 | - | NC_008261.1 | Clostridium perfringens ATCC 13124 |
26 | 2019620 | 2019883 | - | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
27 | 121399 | 121689 | + | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
28 | 2860392 | 2860673 | + | NZ_CP061799.1 | Desulfonema limicola |
29 | 1298180 | 1298434 | + | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
30 | 1560055 | 1560339 | + | NZ_CP011388.1 | Paenibacillus swuensis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03796.17 | 0.72 | 21 | 1006 | same-strand | DnaB-like helicase C terminal domain |
2 | PF00772.23 | 0.72 | 21 | 1006 | same-strand | DnaB-like helicase N terminal domain |
3 | PF13481.8 | 0.69 | 20 | 1183.5 | same-strand | AAA domain |
4 | PF01281.21 | 0.9 | 26 | 1000.5 | same-strand | Ribosomal protein L9, N-terminal domain |
5 | PF03948.16 | 0.9 | 26 | 1000.5 | same-strand | Ribosomal protein L9, C-terminal domain |
6 | PF00436.27 | 0.97 | 28 | 76.5 | same-strand | Single-strand binding protein family |
7 | PF01250.19 | 1.0 | 29 | 549 | same-strand | Ribosomal protein S6 |