Result : EXP00068
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00068 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3520079 |
| Right | 3520180 |
| Strand | - |
| Nucleotide Sequence | ATGCCGACGCCGGCCAGTTTGGCGATGGCGGCCGGGGCGGTGTCCAGTCCCTGCTCGGCGAATGCCTTGGCGGCCACCTCGAGGATGCGGGCCCGATTCTGA |
| Sequence | MPTPASLAMAAGAVSSPCSANALAATSRMRARF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 33 |
++ More..
| Conservation Analysis |
No. of Species: 18
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3583210 | 3583311 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 8313421 | 8313516 | + | NZ_CP047020.1 | Streptomyces broussonetiae |
| 3 | 2670762 | 2670863 | + | NZ_CP047020.1 | Streptomyces broussonetiae |
| 4 | 4945139 | 4945234 | + | NZ_CP043661.1 | Kribbella qitaiheensis |
| 5 | 4952519 | 4952620 | + | NZ_CP029254.1 | Streptomyces spongiicola |
| 6 | 7239473 | 7239574 | - | NZ_CP065050.1 | Streptomyces solisilvae |
| 7 | 7511481 | 7511576 | + | NZ_CP071839.1 | Streptomyces cyanogenus |
| 8 | 1645653 | 1645754 | + | NZ_AP023396.1 | Nocardia wallacei |
| 9 | 2684334 | 2684429 | - | NZ_CP032624.1 | Gryllotalpicola protaetiae |
| 10 | 5697443 | 5697544 | + | NZ_CP008953.1 | Amycolatopsis japonica |
| 11 | 2615619 | 2615720 | - | NC_021252.1 | Amycolatopsis keratiniphila |
| 12 | 553425 | 553520 | + | NC_013729.1 | Kribbella flavida DSM 17836 |
| 13 | 3230463 | 3230564 | + | NZ_LR134352.1 | Nocardia asteroides |
| 14 | 121960 | 122052 | - | NZ_CP029331.1 | Thauera hydrothermalis |
| 15 | 5997282 | 5997374 | + | NZ_CP009365.1 | Pseudomonas soli |
| 16 | 1165443 | 1165547 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 17 | 2880863 | 2880967 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 18 | 1159810 | 1159914 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 19 | 2978469 | 2978573 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00440.25 | 0.94 | 17 | -101.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
++ More..