Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00066 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 3257910 |
Right | 3258143 |
Strand | - |
Nucleotide Sequence | ATGACAGCAGCCGGGAACTTTCGCCTCGCCGGGTCCCGGACCGAACGCGAGATCAGCGTCGCCGGGGTGCCGTGGCCTGCGTACAAGCTGATCGCACTCGCCGTGGGTGCCGTCGTCCTTCTTGTGGTCGCCGCCGTGACGATGACCGCGAGCACAGCGGTGCTCTCGGCCGCCGCGGCCGCCACCGTCACCTGGCTGGCGCTCGGGACGTCCTCACGCACGTCCCGCCGCTGA |
Sequence | MTAAGNFRLAGSRTEREISVAGVPWPAYKLIALAVGAVVLLVVAAVTMTASTAVLSAAAAATVTWLALGTSSRTSRR |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 77 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3318781 | 3319014 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
2 | 5119373 | 5119606 | + | NZ_CP012150.1 | Mycobacterium goodii |
3 | 1533275 | 1533505 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
4 | 4639368 | 4639598 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
5 | 986801 | 987031 | + | NZ_AP022565.1 | Mycolicibacterium alvei |
6 | 3030891 | 3031121 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
7 | 2269469 | 2269699 | + | NZ_AP022605.1 | Mycobacterium doricum |
8 | 899187 | 899417 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
9 | 6356028 | 6356258 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
10 | 4617431 | 4617670 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
11 | 2772753 | 2772983 | - | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
12 | 2703942 | 2704181 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
13 | 4011869 | 4012102 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
14 | 5161302 | 5161490 | + | NZ_AP022599.1 | Mycolicibacterium pulveris |
15 | 2133500 | 2133688 | - | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF07733.14 | 0.87 | 13 | 422 | opposite-strand | Bacterial DNA polymerase III alpha NTPase domain |
2 | PF17657.3 | 0.87 | 13 | 422 | opposite-strand | Bacterial DNA polymerase III alpha subunit finger domain |
3 | PF02811.21 | 0.87 | 13 | 422 | opposite-strand | PHP domain |
4 | PF14579.8 | 0.87 | 13 | 422 | opposite-strand | Helix-hairpin-helix motif |
5 | PF00291.27 | 0.93 | 14 | 565.0 | opposite-strand | Pyridoxal-phosphate dependent enzyme |
6 | PF00585.20 | 0.93 | 14 | 565.0 | opposite-strand | C-terminal regulatory domain of Threonine dehydratase |
7 | PF11941.10 | 0.8 | 12 | 1930.0 | same-strand | Domain of unknown function (DUF3459) |
8 | PF02922.20 | 0.6 | 9 | 5897 | same-strand | Carbohydrate-binding module 48 (Isoamylase N-terminal domain) |