Result : EXP00066
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00066 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3257910 |
| Right | 3258143 |
| Strand | - |
| Nucleotide Sequence | ATGACAGCAGCCGGGAACTTTCGCCTCGCCGGGTCCCGGACCGAACGCGAGATCAGCGTCGCCGGGGTGCCGTGGCCTGCGTACAAGCTGATCGCACTCGCCGTGGGTGCCGTCGTCCTTCTTGTGGTCGCCGCCGTGACGATGACCGCGAGCACAGCGGTGCTCTCGGCCGCCGCGGCCGCCACCGTCACCTGGCTGGCGCTCGGGACGTCCTCACGCACGTCCCGCCGCTGA |
| Sequence | MTAAGNFRLAGSRTEREISVAGVPWPAYKLIALAVGAVVLLVVAAVTMTASTAVLSAAAAATVTWLALGTSSRTSRR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 77 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3318781 | 3319014 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5119373 | 5119606 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 1533275 | 1533505 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
| 4 | 4639368 | 4639598 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 5 | 986801 | 987031 | + | NZ_AP022565.1 | Mycolicibacterium alvei |
| 6 | 3030891 | 3031121 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 7 | 2269469 | 2269699 | + | NZ_AP022605.1 | Mycobacterium doricum |
| 8 | 899187 | 899417 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 9 | 6356028 | 6356258 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 10 | 4617431 | 4617670 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 11 | 2772753 | 2772983 | - | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 12 | 2703942 | 2704181 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
| 13 | 4011869 | 4012102 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 14 | 5161302 | 5161490 | + | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 15 | 2133500 | 2133688 | - | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07733.14 | 0.87 | 13 | 422 | opposite-strand | Bacterial DNA polymerase III alpha NTPase domain |
| 2 | PF17657.3 | 0.87 | 13 | 422 | opposite-strand | Bacterial DNA polymerase III alpha subunit finger domain |
| 3 | PF02811.21 | 0.87 | 13 | 422 | opposite-strand | PHP domain |
| 4 | PF14579.8 | 0.87 | 13 | 422 | opposite-strand | Helix-hairpin-helix motif |
| 5 | PF00291.27 | 0.93 | 14 | 565.0 | opposite-strand | Pyridoxal-phosphate dependent enzyme |
| 6 | PF00585.20 | 0.93 | 14 | 565.0 | opposite-strand | C-terminal regulatory domain of Threonine dehydratase |
| 7 | PF11941.10 | 0.8 | 12 | 1930.0 | same-strand | Domain of unknown function (DUF3459) |
| 8 | PF02922.20 | 0.6 | 9 | 5897 | same-strand | Carbohydrate-binding module 48 (Isoamylase N-terminal domain) |
++ More..