Result : EXP00064
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00064 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2817697 |
| Right | 2817741 |
| Strand | - |
| Nucleotide Sequence | ATGCGGGGCGGCGCGCGCCTGCCGGACCGGAATGCGCGACACTAG |
| Sequence | MRGGARLPDRNARH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2884066 | 2884110 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5493094 | 5493138 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01476.22 | 1.0 | 2 | 3493.5 | opposite-strand | LysM domain |
| 2 | PF03477.18 | 1.0 | 2 | 2879.5 | opposite-strand | ATP cone domain |
| 3 | PF12697.9 | 1.0 | 2 | 1128.0 | same-strand | Alpha/beta hydrolase family |
| 4 | PF12146.10 | 1.0 | 2 | 1128.0 | same-strand | Serine aminopeptidase, S33 |
| 5 | PF09754.11 | 1.0 | 2 | 65.0 | same-strand | PAC2 family |
| 6 | PF13365.8 | 1.0 | 2 | 93.0 | opposite-strand | Trypsin-like peptidase domain |
| 7 | PF07992.16 | 1.0 | 2 | 933.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 8 | PF02852.24 | 1.0 | 2 | 933.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 9 | PF00070.29 | 1.0 | 2 | 933.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 10 | PF13830.8 | 1.0 | 2 | 2398.5 | opposite-strand | Domain of unknown function (DUF4192) |
| 11 | PF02742.17 | 1.0 | 2 | 3607.0 | same-strand | Iron dependent repressor, metal binding and dimerisation domain |
| 12 | PF01325.21 | 1.0 | 2 | 3607.0 | same-strand | Iron dependent repressor, N-terminal DNA binding domain |
| 13 | PF18357.3 | 1.0 | 2 | 3607.0 | same-strand | Diphteria toxin repressor SH3 domain |
| 14 | PF04023.16 | 1.0 | 2 | 3607.0 | same-strand | FeoA domain |
| 15 | PF13463.8 | 1.0 | 2 | 3607.0 | same-strand | Winged helix DNA-binding domain |
| 16 | PF04539.18 | 1.0 | 2 | 4527.5 | same-strand | Sigma-70 region 3 |
| 17 | PF04542.16 | 1.0 | 2 | 4527.5 | same-strand | Sigma-70 region 2 |
| 18 | PF04545.18 | 1.0 | 2 | 4527.5 | same-strand | Sigma-70, region 4 |
| 19 | PF00140.22 | 1.0 | 2 | 4527.5 | same-strand | Sigma-70 factor, region 1.2 |
++ More..