Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00063 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 2480312 |
Right | 2480359 |
Strand | - |
Nucleotide Sequence | ATGCAGCGAGACGGAGGAGACTGCGGGTGGTCGAGGCGTACGTGTTGA |
Sequence | MQRDGGDCGWSRRTC |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 15 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2548217 | 2548264 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
2 | 5891420 | 5891467 | + | NZ_CP012150.1 | Mycobacterium goodii |
3 | 1554830 | 1554877 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF07479.16 | 0.67 | 2 | 3119.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus |
2 | PF01210.25 | 0.67 | 2 | 3119.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus |
3 | PF03807.19 | 0.67 | 2 | 3119.5 | opposite-strand | NADP oxidoreductase coenzyme F420-dependent |
4 | PF01053.22 | 0.67 | 2 | 2008.0 | opposite-strand | Cys/Met metabolism PLP-dependent enzyme |
5 | PF07478.15 | 1.0 | 3 | 820 | opposite-strand | D-ala D-ala ligase C-terminus |
6 | PF01820.23 | 1.0 | 3 | 820 | opposite-strand | D-ala D-ala ligase N-terminus |
7 | PF12028.10 | 1.0 | 3 | 232 | same-strand | Protein of unknown function (DUF3515) |
8 | PF01037.23 | 1.0 | 3 | -21 | same-strand | Lrp/AsnC ligand binding domain |
9 | PF00586.26 | 1.0 | 3 | 79 | opposite-strand | AIR synthase related protein, N-terminal domain |
10 | PF03167.21 | 1.0 | 3 | 1076 | opposite-strand | Uracil DNA glycosylase superfamily |
11 | PF00830.21 | 1.0 | 3 | 2195 | same-strand | Ribosomal L28 family |
12 | PF13684.8 | 1.0 | 3 | 2622 | opposite-strand | Dihydroxyacetone kinase family |
13 | PF02734.19 | 1.0 | 3 | 2622 | opposite-strand | DAK2 domain |