Result : EXP00063
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00063 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2480312 |
| Right | 2480359 |
| Strand | - |
| Nucleotide Sequence | ATGCAGCGAGACGGAGGAGACTGCGGGTGGTCGAGGCGTACGTGTTGA |
| Sequence | MQRDGGDCGWSRRTC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2548217 | 2548264 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5891420 | 5891467 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 1554830 | 1554877 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07479.16 | 0.67 | 2 | 3119.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus |
| 2 | PF01210.25 | 0.67 | 2 | 3119.5 | opposite-strand | NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus |
| 3 | PF03807.19 | 0.67 | 2 | 3119.5 | opposite-strand | NADP oxidoreductase coenzyme F420-dependent |
| 4 | PF01053.22 | 0.67 | 2 | 2008.0 | opposite-strand | Cys/Met metabolism PLP-dependent enzyme |
| 5 | PF07478.15 | 1.0 | 3 | 820 | opposite-strand | D-ala D-ala ligase C-terminus |
| 6 | PF01820.23 | 1.0 | 3 | 820 | opposite-strand | D-ala D-ala ligase N-terminus |
| 7 | PF12028.10 | 1.0 | 3 | 232 | same-strand | Protein of unknown function (DUF3515) |
| 8 | PF01037.23 | 1.0 | 3 | -21 | same-strand | Lrp/AsnC ligand binding domain |
| 9 | PF00586.26 | 1.0 | 3 | 79 | opposite-strand | AIR synthase related protein, N-terminal domain |
| 10 | PF03167.21 | 1.0 | 3 | 1076 | opposite-strand | Uracil DNA glycosylase superfamily |
| 11 | PF00830.21 | 1.0 | 3 | 2195 | same-strand | Ribosomal L28 family |
| 12 | PF13684.8 | 1.0 | 3 | 2622 | opposite-strand | Dihydroxyacetone kinase family |
| 13 | PF02734.19 | 1.0 | 3 | 2622 | opposite-strand | DAK2 domain |
++ More..