Result : EXP00056
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00056 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1893865 |
| Right | 1893939 |
| Strand | - |
| Nucleotide Sequence | ATGACCTGCGCTGTATACACGATTCCGCATCCGAGCATGCGTTTCCGTACACTGGCTAATCGTGTCCTTCGCTGA |
| Sequence | MTCAVYTIPHPSMRFRTLANRVLR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1966148 | 1966222 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 6386271 | 6386345 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 3700764 | 3700838 | + | NZ_AP022612.1 | Mycolicibacterium confluentis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03703.16 | 1.0 | 3 | 613 | opposite-strand | Bacterial PH domain |
| 2 | PF04138.16 | 1.0 | 3 | -13 | same-strand | GtrA-like protein |
| 3 | PF02222.24 | 1.0 | 3 | 64 | opposite-strand | ATP-grasp domain |
| 4 | PF17769.3 | 1.0 | 3 | 64 | opposite-strand | Phosphoribosylaminoimidazole carboxylase C-terminal domain |
| 5 | PF00731.22 | 1.0 | 3 | 1239 | opposite-strand | AIR carboxylase |
| 6 | PF00441.26 | 1.0 | 3 | 2093 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 7 | PF02771.18 | 1.0 | 3 | 2093 | opposite-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 8 | PF02770.21 | 1.0 | 3 | 2093 | opposite-strand | Acyl-CoA dehydrogenase, middle domain |
| 9 | PF08028.13 | 1.0 | 3 | 2093 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 10 | PF03099.21 | 0.67 | 2 | 3284.5 | opposite-strand | Biotin/lipoate A/B protein ligase family |
| 11 | PF02237.19 | 0.67 | 2 | 3284.5 | opposite-strand | Biotin protein ligase C terminal domain |
| 12 | PF02397.18 | 0.67 | 2 | 2834.0 | both-strands | Bacterial sugar transferase |
| 13 | PF13727.8 | 0.67 | 2 | 2834.0 | both-strands | CoA-binding domain |
++ More..