Result : EXP00053
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00053 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1742516 |
| Right | 1742575 |
| Strand | - |
| Nucleotide Sequence | ATGTCGATCACTTCGATGGCCGCCCCGGTCGCGGCCTTCATCCGGCCCCGCACCGCCTAG |
| Sequence | MSITSMAAPVAAFIRPRTA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1814534 | 1814593 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 6567012 | 6567068 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02882.21 | 1.0 | 2 | 1127.5 | opposite-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain |
| 2 | PF00763.25 | 1.0 | 2 | 1127.5 | opposite-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain |
| 3 | PF00440.25 | 1.0 | 2 | 103.5 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 4 | PF01494.21 | 1.0 | 2 | 722.0 | opposite-strand | FAD binding domain |
| 5 | PF08241.14 | 1.0 | 2 | 2271.0 | same-strand | Methyltransferase domain |
| 6 | PF13649.8 | 1.0 | 2 | 2270 | same-strand | Methyltransferase domain |
| 7 | PF08242.14 | 1.0 | 2 | 2271.0 | same-strand | Methyltransferase domain |
| 8 | PF00561.22 | 1.0 | 2 | 3005.0 | same-strand | alpha/beta hydrolase fold |
| 9 | PF01053.22 | 1.0 | 2 | 4167.5 | same-strand | Cys/Met metabolism PLP-dependent enzyme |
++ More..