Result : B0SMJ9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L28 |
| NCBI Accession ID | CP000786.1 |
| Organism | Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) |
| Left | 1064574 |
| Right | 1064864 |
| Strand | + |
| Nucleotide Sequence | ATGGCTAGAACATGTGTAGTAACCGGAAAAGGAACAACGGCAGGGAACAACGTATCCCATTCTCATAAAAAGAACCGCCGTATCTGGAAGGTGAATGTGATCACAAAAAAAATCTTTTTGGAAGACGAGAACCGTTGGGTTCGCGTGAAGATTTCTACACGTGCTTTACGAACCCTTCGTAAAAAAGGTTTGAAAGTGGCAATCAAAGACCACGGCGGTGACATCACTGCGATCACTCCTAAAAAATACGTAGGAATCACTCCCAAAGCACAACCAGTAGCAACTGCTTAA |
| Sequence | MARTCVVTGKGTTAGNNVSHSHKKNRRIWKVNVITKKIFLEDENRWVRVKISTRALRTLRKKGLKVAIKDHGGDITAITPKKYVGITPKAQPVATA |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00367. Profile Description: Ribosomal L28 family. This model describes bacterial and chloroplast forms of the 50S ribosomal protein L28, a polypeptide about 60 amino acids in length. Mitochondrial homologs differ substantially in architecture (e.g. SP|P36525 from Saccharomyces cerevisiae, which is 258 amino acids long) and are not included. [Protein synthesis, Ribosomal proteins: synthesis and modification] |
| Pubmed ID | 18270594 |
| Domain | CDD:412338 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B0SMJ9 |
| ORF Length (Amino Acid) | 96 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2884065 | 2884349 | + | NZ_CP030142.1 | Leptospira mayottensis |
| 2 | 2641098 | 2641382 | - | NZ_CP040840.1 | Leptospira weilii |
| 3 | 162126 | 162410 | - | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
| 4 | 1954732 | 1955016 | + | NZ_CP015217.1 | Leptospira tipperaryensis |
| 5 | 290577 | 290861 | + | NZ_CP033614.1 | Leptospira kmetyi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP030142.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02878.18 | 0.8 | 4 | 3249.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 2 | PF02880.18 | 0.8 | 4 | 3249.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
| 3 | PF00155.23 | 1.0 | 5 | 1956 | same-strand | Aminotransferase class I and II |
| 4 | PF00730.27 | 1.0 | 5 | -58 | same-strand | HhH-GPD superfamily base excision DNA repair protein |
| 5 | PF00633.25 | 1.0 | 5 | 750.0 | same-strand | Helix-hairpin-helix motif |
| 6 | PF03061.24 | 1.0 | 5 | 653 | same-strand | Thioesterase superfamily |
| 7 | PF00472.22 | 1.0 | 5 | 1082 | same-strand | RF-1 domain |
| 8 | PF08459.13 | 1.0 | 5 | 1584 | same-strand | UvrC RIbonuclease H-like domain |
| 9 | PF01541.26 | 1.0 | 5 | 1584 | same-strand | GIY-YIG catalytic domain |
| 10 | PF02151.21 | 1.0 | 5 | 1584 | same-strand | UvrB/uvrC motif |
| 11 | PF14520.8 | 1.0 | 5 | 1584 | same-strand | Helix-hairpin-helix domain |
++ More..