Protein Information |
Information Type | Description |
---|---|
Protein name | 50S ribosomal protein L28 |
NCBI Accession ID | CP000786.1 |
Organism | Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) |
Left | 1064574 |
Right | 1064864 |
Strand | + |
Nucleotide Sequence | ATGGCTAGAACATGTGTAGTAACCGGAAAAGGAACAACGGCAGGGAACAACGTATCCCATTCTCATAAAAAGAACCGCCGTATCTGGAAGGTGAATGTGATCACAAAAAAAATCTTTTTGGAAGACGAGAACCGTTGGGTTCGCGTGAAGATTTCTACACGTGCTTTACGAACCCTTCGTAAAAAAGGTTTGAAAGTGGCAATCAAAGACCACGGCGGTGACATCACTGCGATCACTCCTAAAAAATACGTAGGAATCACTCCCAAAGCACAACCAGTAGCAACTGCTTAA |
Sequence | MARTCVVTGKGTTAGNNVSHSHKKNRRIWKVNVITKKIFLEDENRWVRVKISTRALRTLRKKGLKVAIKDHGGDITAITPKKYVGITPKAQPVATA |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of cl00367. Profile Description: Ribosomal L28 family. This model describes bacterial and chloroplast forms of the 50S ribosomal protein L28, a polypeptide about 60 amino acids in length. Mitochondrial homologs differ substantially in architecture (e.g. SP|P36525 from Saccharomyces cerevisiae, which is 258 amino acids long) and are not included. [Protein synthesis, Ribosomal proteins: synthesis and modification] |
Pubmed ID | 18270594 |
Domain | CDD:412338 |
Functional Category | Ribosomal_protein |
Uniprot ID | B0SMJ9 |
ORF Length (Amino Acid) | 96 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2884065 | 2884349 | + | NZ_CP030142.1 | Leptospira mayottensis |
2 | 2641098 | 2641382 | - | NZ_CP040840.1 | Leptospira weilii |
3 | 162126 | 162410 | - | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
4 | 1954732 | 1955016 | + | NZ_CP015217.1 | Leptospira tipperaryensis |
5 | 290577 | 290861 | + | NZ_CP033614.1 | Leptospira kmetyi |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF02878.18 | 0.8 | 4 | 3249.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
2 | PF02880.18 | 0.8 | 4 | 3249.0 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
3 | PF00155.23 | 1.0 | 5 | 1956 | same-strand | Aminotransferase class I and II |
4 | PF00730.27 | 1.0 | 5 | -58 | same-strand | HhH-GPD superfamily base excision DNA repair protein |
5 | PF00633.25 | 1.0 | 5 | 750.0 | same-strand | Helix-hairpin-helix motif |
6 | PF03061.24 | 1.0 | 5 | 653 | same-strand | Thioesterase superfamily |
7 | PF00472.22 | 1.0 | 5 | 1082 | same-strand | RF-1 domain |
8 | PF08459.13 | 1.0 | 5 | 1584 | same-strand | UvrC RIbonuclease H-like domain |
9 | PF01541.26 | 1.0 | 5 | 1584 | same-strand | GIY-YIG catalytic domain |
10 | PF02151.21 | 1.0 | 5 | 1584 | same-strand | UvrB/uvrC motif |
11 | PF14520.8 | 1.0 | 5 | 1584 | same-strand | Helix-hairpin-helix domain |