Result : EXP00040
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00040 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6441234 |
| Right | 6441284 |
| Strand | + |
| Nucleotide Sequence | ATGTCCCCGAGGCTTGGAGCTGCAGTAGATGGTGTTCGACGCCGTAGGTAA |
| Sequence | MSPRLGAAVDGVRRRR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6458643 | 6458693 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 2985676 | 2985726 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 3 | 5906307 | 5906357 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022567.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00141.25 | 1.0 | 3 | 2107 | same-strand | Peroxidase |
| 2 | PF00106.27 | 1.0 | 3 | -22 | same-strand | short chain dehydrogenase |
| 3 | PF08659.12 | 1.0 | 3 | -22 | same-strand | KR domain |
| 4 | PF12250.10 | 1.0 | 3 | 742 | same-strand | Arabinofuranosyltransferase N terminal |
| 5 | PF12249.10 | 1.0 | 3 | 742 | same-strand | Arabinofuranosyltransferase A C terminal |
| 6 | PF04602.14 | 1.0 | 3 | 6003 | same-strand | Mycobacterial cell wall arabinan synthesis protein |
| 7 | PF14896.8 | 1.0 | 3 | 6003 | same-strand | EmbC C-terminal domain |
| 8 | PF17689.3 | 1.0 | 3 | 6003 | same-strand | Arabinosyltransferase concanavalin like domain |
| 9 | PF09995.11 | 0.67 | 2 | 908.0 | opposite-strand | ER-bound oxygenase mpaB/B'/Rubber oxygenase, catalytic domain |
| 10 | PF00440.25 | 0.67 | 2 | 1420 | opposite-strand | Bacterial regulatory proteins, tetR family |
++ More..