Result : EXP00039
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00039 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6348005 |
| Right | 6348085 |
| Strand | + |
| Nucleotide Sequence | GTGACGAATTCGACGAGCTGTACGGCGGTGAGGTCTACAACACCGTCAAGAAGACGTACGACCCGGATTCACGTCTGCTAG |
| Sequence | VTNSTSCTAVRSTTPSRRRTTRIHVC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6354860 | 6354940 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 757644 | 757724 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13662.8 | 1.0 | 2 | 3103.0 | opposite-strand | Toprim domain |
| 2 | PF02132.17 | 1.0 | 2 | 3103.0 | opposite-strand | RecR protein |
| 3 | PF01751.24 | 1.0 | 2 | 3103.0 | opposite-strand | Toprim domain |
| 4 | PF02575.18 | 1.0 | 2 | 2784.0 | opposite-strand | YbaB/EbfC DNA-binding family |
| 5 | PF01520.20 | 1.0 | 2 | 1840.0 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 6 | PF10604.11 | 1.0 | 2 | 1378.0 | opposite-strand | Polyketide cyclase / dehydrase and lipid transport |
| 7 | PF02353.22 | 1.0 | 2 | 29.0 | same-strand | Mycolic acid cyclopropane synthetase |
| 8 | PF08241.14 | 1.0 | 2 | 29.0 | same-strand | Methyltransferase domain |
| 9 | PF13649.8 | 1.0 | 2 | 29.0 | same-strand | Methyltransferase domain |
| 10 | PF08242.14 | 1.0 | 2 | 29.0 | same-strand | Methyltransferase domain |
| 11 | PF13177.8 | 1.0 | 2 | 2297.0 | opposite-strand | DNA polymerase III, delta subunit |
| 12 | PF12169.10 | 1.0 | 2 | 2297.0 | opposite-strand | DNA polymerase III subunits gamma and tau domain III |
| 13 | PF00004.31 | 1.0 | 2 | 2297.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 14 | PF13401.8 | 1.0 | 2 | 2297.0 | opposite-strand | AAA domain |
| 15 | PF12897.9 | 1.0 | 2 | 4313.5 | opposite-strand | Aspartate amino-transferase |
| 16 | PF00155.23 | 1.0 | 2 | 3402 | opposite-strand | Aminotransferase class I and II |
++ More..