Result : EXP00036
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00036 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5858964 |
| Right | 5859056 |
| Strand | + |
| Nucleotide Sequence | GTGTCAACCCGCCTTGAGCTCTCGCTCACCAAGCGCCGCGCAGTGGATCTGTGCCGCGTTGCGGGTTGTTGCTGTTGTTGTTGTTGCTGTTGA |
| Sequence | VSTRLELSLTKRRAVDLCRVAGCCCCCCCC |
| Source of smORF | Ribo-seq |
| Function | It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 30
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5877058 | 5877150 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5454180 | 5454272 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 3 | 695277 | 695366 | - | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 4 | 4410457 | 4410546 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 5 | 1003475 | 1003567 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 6 | 2096218 | 2096304 | + | NZ_LS483468.1 | Rhodococcus coprophilus |
| 7 | 852456 | 852539 | - | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 8 | 1355111 | 1355194 | - | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 9 | 6282726 | 6282818 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 10 | 1278067 | 1278159 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 11 | 3374455 | 3374544 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 12 | 3542229 | 3542318 | + | NZ_AP022582.1 | Mycobacterium seoulense |
| 13 | 2497551 | 2497643 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 14 | 2517378 | 2517458 | + | NZ_CP033972.1 | Gordonia insulae |
| 15 | 3412122 | 3412202 | - | NZ_CP023698.1 | Streptomyces viridifaciens |
| 16 | 338014 | 338091 | + | NC_009380.1 | Salinispora tropica CNB-440 |
| 17 | 63855 | 63941 | + | NC_008578.1 | Acidothermus cellulolyticus 11B |
| 18 | 3383433 | 3383519 | - | NZ_CP015866.1 | Streptomyces parvulus |
| 19 | 4956533 | 4956613 | - | NC_003155.5 | Streptomyces avermitilis MA-4680 = NBRC 14893 |
| 20 | 4139513 | 4139599 | + | NZ_CP029196.1 | Streptomyces venezuelae |
| 21 | 4643757 | 4643837 | + | NZ_CP047020.1 | Streptomyces broussonetiae |
| 22 | 6800816 | 6800905 | - | NZ_CP058322.1 | Micromonospora carbonacea |
| 23 | 4677346 | 4677426 | - | NZ_CP045096.1 | Streptomyces phaeolivaceus |
| 24 | 4131689 | 4131769 | - | NC_021985.1 | Streptomyces collinus Tu 365 |
| 25 | 594979 | 595056 | - | NZ_CP022310.1 | Streptomyces calvus |
| 26 | 281759 | 281842 | - | NZ_CP031742.1 | Streptomyces koyangensis |
| 27 | 4122284 | 4122367 | + | NZ_CP019066.1 | Tsukamurella tyrosinosolvens |
| 28 | 4832921 | 4833001 | + | NC_016109.1 | Kitasatospora setae KM-6054 |
| 29 | 959107 | 959196 | + | NZ_CP022753.1 | Nocardiopsis gilva YIM 90087 |
| 30 | 762389 | 762469 | - | NZ_CP011853.1 | Gordonia phthalatica |
| 31 | 7738460 | 7738552 | - | NC_014666.1 | Frankia inefficax |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00486.30 | 0.8 | 24 | 1447.0 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 2 | PF11209.10 | 0.87 | 26 | 238.0 | same-strand | LmeA-like phospholipid-binding |
| 3 | PF00581.22 | 0.9 | 27 | 243 | same-strand | Rhodanese-like domain |
| 4 | PF07210.14 | 0.9 | 27 | 1107 | same-strand | Protein of unknown function (DUF1416) |
++ More..