Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00021 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 3318412 |
Right | 3318498 |
Strand | + |
Nucleotide Sequence | GTGCGCGCTGGGTCCATGGTCGTTAACGTTTCCGGGTTGGAACGGGGCGGAACACGACCCGAGGCAGAAAGTAGAGGCAACCTGTGA |
Sequence | VRAGSMVVNVSGLERGGTRPEAESRGNL |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 28 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3379206 | 3379292 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
2 | 5055543 | 5055629 | - | NZ_CP012150.1 | Mycobacterium goodii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00005.29 | 1.0 | 2 | 3416.5 | opposite-strand | ABC transporter |
2 | PF00664.25 | 1.0 | 2 | 3416.5 | opposite-strand | ABC transporter transmembrane region |
3 | PF02322.17 | 1.0 | 2 | 2264.0 | opposite-strand | Cytochrome bd terminal oxidase subunit II |
4 | PF01654.19 | 1.0 | 2 | 788.0 | opposite-strand | Cytochrome bd terminal oxidase subunit I |
5 | PF03729.15 | 1.0 | 2 | 93.0 | opposite-strand | Short repeat of unknown function (DUF308) |
6 | PF00497.22 | 1.0 | 2 | 30.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
7 | PF00528.24 | 1.0 | 2 | 927.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
8 | PF02463.21 | 1.0 | 2 | 1856.5 | same-strand | RecF/RecN/SMC N terminal domain |
9 | PF00581.22 | 1.0 | 2 | 2672.0 | same-strand | Rhodanese-like domain |
10 | PF19354.1 | 1.0 | 2 | 3567.5 | same-strand | Family of unknown function (DUF5931) |
11 | PF02518.28 | 1.0 | 2 | 3567.5 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |