Result : EXP00021
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00021 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3318412 |
| Right | 3318498 |
| Strand | + |
| Nucleotide Sequence | GTGCGCGCTGGGTCCATGGTCGTTAACGTTTCCGGGTTGGAACGGGGCGGAACACGACCCGAGGCAGAAAGTAGAGGCAACCTGTGA |
| Sequence | VRAGSMVVNVSGLERGGTRPEAESRGNL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3379206 | 3379292 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5055543 | 5055629 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 2 | 3416.5 | opposite-strand | ABC transporter |
| 2 | PF00664.25 | 1.0 | 2 | 3416.5 | opposite-strand | ABC transporter transmembrane region |
| 3 | PF02322.17 | 1.0 | 2 | 2264.0 | opposite-strand | Cytochrome bd terminal oxidase subunit II |
| 4 | PF01654.19 | 1.0 | 2 | 788.0 | opposite-strand | Cytochrome bd terminal oxidase subunit I |
| 5 | PF03729.15 | 1.0 | 2 | 93.0 | opposite-strand | Short repeat of unknown function (DUF308) |
| 6 | PF00497.22 | 1.0 | 2 | 30.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 7 | PF00528.24 | 1.0 | 2 | 927.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 8 | PF02463.21 | 1.0 | 2 | 1856.5 | same-strand | RecF/RecN/SMC N terminal domain |
| 9 | PF00581.22 | 1.0 | 2 | 2672.0 | same-strand | Rhodanese-like domain |
| 10 | PF19354.1 | 1.0 | 2 | 3567.5 | same-strand | Family of unknown function (DUF5931) |
| 11 | PF02518.28 | 1.0 | 2 | 3567.5 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
++ More..