Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00020 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 3076240 |
Right | 3076311 |
Strand | + |
Nucleotide Sequence | GTGATCCAGATCGCACTGAAGCGCAGGTTCGACGCCCTCCGGCACGTCGGTTCAGCGGCGGAGTTCGCGTGA |
Sequence | VIQIALKRRFDALRHVGSAAEFA |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 23 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3139155 | 3139226 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
2 | 5308497 | 5308568 | - | NZ_CP012150.1 | Mycobacterium goodii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00152.22 | 1.0 | 2 | 4350.0 | same-strand | tRNA synthetases class II (D, K and N) |
2 | PF01336.27 | 1.0 | 2 | 4350.0 | same-strand | OB-fold nucleic acid binding domain |
3 | PF02938.16 | 1.0 | 2 | 4350.0 | same-strand | GAD domain |
4 | PF04075.16 | 1.0 | 2 | 3844.5 | same-strand | F420H(2)-dependent quinone reductase |
5 | PF02737.20 | 1.0 | 2 | 2861.0 | opposite-strand | 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain |
6 | PF00725.24 | 1.0 | 2 | 2861.0 | opposite-strand | 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain |
7 | PF00465.21 | 1.0 | 2 | 1590.0 | opposite-strand | Iron-containing alcohol dehydrogenase |
8 | PF00171.24 | 1.0 | 2 | -44.0 | opposite-strand | Aldehyde dehydrogenase family |
9 | PF02954.21 | 1.0 | 2 | 15.0 | same-strand | Bacterial regulatory protein, Fis family |
10 | PF18024.3 | 1.0 | 2 | 15.0 | same-strand | Helix-turn-helix domain |
11 | PF13561.8 | 1.0 | 2 | 1753.5 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
12 | PF00106.27 | 1.0 | 2 | 1753.5 | opposite-strand | short chain dehydrogenase |
13 | PF08659.12 | 1.0 | 2 | 1753.5 | opposite-strand | KR domain |
14 | PF07859.15 | 1.0 | 2 | 2631.5 | same-strand | alpha/beta hydrolase fold |