Result : EXP00016
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00016 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2333275 |
| Right | 2333310 |
| Strand | + |
| Nucleotide Sequence | ATGTCCGGGCAGAGAGGATGCCGATGCATTGTCTGA |
| Sequence | MSGQRGCRCIV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6032404 | 6032439 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 2405663 | 2405698 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00190.24 | 1.0 | 2 | 2167.5 | same-strand | Cupin |
| 2 | PF07883.13 | 1.0 | 2 | 2167.5 | same-strand | Cupin domain |
| 3 | PF01494.21 | 1.0 | 2 | 411.0 | same-strand | FAD binding domain |
| 4 | PF00072.26 | 1.0 | 2 | -12.0 | same-strand | Response regulator receiver domain |
| 5 | PF07730.15 | 1.0 | 2 | 107.5 | opposite-strand | Histidine kinase |
| 6 | PF02518.28 | 1.0 | 2 | 107.5 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 7 | PF13185.8 | 1.0 | 2 | 107.5 | opposite-strand | GAF domain |
| 8 | PF08448.12 | 1.0 | 2 | 107.5 | opposite-strand | PAS fold |
| 9 | PF13493.8 | 1.0 | 2 | 107.5 | opposite-strand | Domain of unknown function (DUF4118) |
| 10 | PF00296.22 | 1.0 | 2 | 2329 | same-strand | Luciferase-like monooxygenase |
| 11 | PF11716.10 | 1.0 | 2 | 4067.0 | opposite-strand | Mycothiol maleylpyruvate isomerase N-terminal domain |
| 12 | PF13577.8 | 1.0 | 2 | 4733.0 | same-strand | SnoaL-like domain |
| 13 | PF12680.9 | 1.0 | 2 | 4733.0 | same-strand | SnoaL-like domain |
++ More..