ProsmORF-pred
Result : EXP00009
Protein Information
Information Type Description
Protein name EXP00009
NCBI Accession ID CP000480.1
Organism Mycolicibacterium smegmatis MC2 155
Left 1458621
Right 1458761
Strand +
Nucleotide Sequence GTGACTGTCGAGGCGGAACGCCCGATACCCATCACAAGGAGGCATGCATGGCCAAGGCTGACAAGGCCACGGCGGTTGCCGACATTGCCGAGCAGTTCAAGGCGTCGACGGCCACCGTCGTCACCGAGTACCGCGGGCTGA
Sequence VTVEAERPIPITRRHAWPRLTRPRRLPTLPSSSRRRRPPSSPSTAG
Source of smORF Ribo-seq
Function
Pubmed ID 26536359
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 46
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 3
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 1535790 1535930 + NZ_LN831039.1 Mycolicibacterium smegmatis
2 4336804 4336932 + NZ_AP022567.1 Mycolicibacterium mageritense
3 3802778 3802903 - NZ_AP022617.1 Mycolicibacterium monacense
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_LN831039.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF03372.25 0.67 2 6102.0 same-strand Endonuclease/Exonuclease/phosphatase family
2 PF01074.24 1.0 3 1990 same-strand Glycosyl hydrolases family 38 N-terminal domain
3 PF10633.11 1.0 3 1990 same-strand NPCBM-associated, NEW3 domain of alpha-galactosidase
4 PF09261.13 1.0 3 1990 same-strand Alpha mannosidase middle domain
5 PF00480.22 1.0 3 475 same-strand ROK family
6 PF00466.22 1.0 3 -93 same-strand Ribosomal protein L10
7 PF00542.21 1.0 3 492 same-strand Ribosomal protein L7/L12 C-terminal domain
8 PF16320.7 1.0 3 492 same-strand Ribosomal protein L7/L12 dimerisation domain
9 PF00005.29 1.0 3 1067 same-strand ABC transporter
10 PF00562.30 1.0 3 2690 same-strand RNA polymerase Rpb2, domain 6
11 PF10385.11 1.0 3 2690 same-strand RNA polymerase beta subunit external 1 domain
12 PF04565.18 1.0 3 2690 same-strand RNA polymerase Rpb2, domain 3
13 PF04561.16 1.0 3 2690 same-strand RNA polymerase Rpb2, domain 2
14 PF04560.22 1.0 3 2690 same-strand RNA polymerase Rpb2, domain 7
15 PF04563.17 0.67 2 2788.5 same-strand RNA polymerase beta subunit
16 PF04997.14 1.0 3 6263 same-strand RNA polymerase Rpb1, domain 1
17 PF04998.19 1.0 3 6263 same-strand RNA polymerase Rpb1, domain 5
18 PF00623.22 1.0 3 6263 same-strand RNA polymerase Rpb1, domain 2
19 PF04983.20 1.0 3 6263 same-strand RNA polymerase Rpb1, domain 3
++ More..