Result : EXP00008
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00008 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1439467 |
| Right | 1439523 |
| Strand | + |
| Nucleotide Sequence | ATGAGCAAGGTAAAGGAACAACACGGATGGCCCCGAAGAAGAAGGTCGCCGGGCTGA |
| Sequence | MSKVKEQHGWPRRRRSPG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6868426 | 6868482 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 1516610 | 1516666 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02353.22 | 1.0 | 2 | 3346.5 | opposite-strand | Mycolic acid cyclopropane synthetase |
| 2 | PF13649.8 | 1.0 | 2 | 3346.5 | opposite-strand | Methyltransferase domain |
| 3 | PF08241.14 | 1.0 | 2 | 3346.5 | opposite-strand | Methyltransferase domain |
| 4 | PF08242.14 | 1.0 | 2 | 3346.5 | opposite-strand | Methyltransferase domain |
| 5 | PF03795.16 | 1.0 | 2 | 2525.0 | opposite-strand | YCII-related domain |
| 6 | PF04542.16 | 1.0 | 2 | 1282.0 | opposite-strand | Sigma-70 region 2 |
| 7 | PF08281.14 | 1.0 | 2 | 1282.0 | opposite-strand | Sigma-70, region 4 |
| 8 | PF04545.18 | 1.0 | 2 | 1282.0 | opposite-strand | Sigma-70, region 4 |
| 9 | PF00687.23 | 1.0 | 2 | 498.5 | same-strand | Ribosomal protein L1p/L10e family |
| 10 | PF03946.16 | 1.0 | 2 | -30.0 | same-strand | Ribosomal protein L11, N-terminal domain |
| 11 | PF00298.21 | 1.0 | 2 | -30.0 | same-strand | Ribosomal protein L11, RNA binding domain |
| 12 | PF02357.21 | 1.0 | 2 | 42.0 | same-strand | Transcription termination factor nusG |
| 13 | PF00584.22 | 1.0 | 2 | 921.5 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
| 14 | PF13452.8 | 1.0 | 2 | 2156.0 | same-strand | N-terminal half of MaoC dehydratase |
| 15 | PF01575.21 | 1.0 | 2 | 2209.0 | same-strand | MaoC like domain |
++ More..