Result : EXP00004
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00004 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1053307 |
| Right | 1053351 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGGTCTGTGGAGGCATGATGCGTTGTCTCATCGTCGATGA |
| Sequence | MSGLWRHDALSHRR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 64234 | 64278 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 1087501 | 1087545 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00083.26 | 1.0 | 2 | 4318.0 | opposite-strand | Sugar (and other) transporter |
| 2 | PF07690.18 | 1.0 | 2 | 4318.0 | opposite-strand | Major Facilitator Superfamily |
| 3 | PF00072.26 | 1.0 | 2 | 1748.5 | both-strands | Response regulator receiver domain |
| 4 | PF00196.21 | 1.0 | 2 | 3540.5 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 5 | PF08281.14 | 1.0 | 2 | 3540.5 | opposite-strand | Sigma-70, region 4 |
| 6 | PF06808.14 | 1.0 | 2 | 1492.0 | same-strand | Tripartite ATP-independent periplasmic transporter, DctM component |
| 7 | PF16868.7 | 1.0 | 2 | 440.0 | same-strand | NMT1-like family |
| 8 | PF13185.8 | 1.0 | 2 | 163.5 | opposite-strand | GAF domain |
| 9 | PF13493.8 | 1.0 | 2 | 163.5 | opposite-strand | Domain of unknown function (DUF4118) |
| 10 | PF01590.28 | 1.0 | 2 | 163.5 | opposite-strand | GAF domain |
| 11 | PF07730.15 | 1.0 | 2 | 163.5 | opposite-strand | Histidine kinase |
| 12 | PF13492.8 | 1.0 | 2 | 163.5 | opposite-strand | GAF domain |
| 13 | PF14012.8 | 1.0 | 2 | 3201.5 | same-strand | Protein of unknown function (DUF4229) |
++ More..