Result : EXP00001
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00001 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 76190 |
| Right | 76234 |
| Strand | + |
| Nucleotide Sequence | ATGTCGGGGAATCGAGGGGATTCATGTCTGACGATCTGCGGGTGA |
| Sequence | MSGNRGDSCLTICG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 76674 | 76718 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1500028 | 1500072 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF18879.2 | 1.0 | 2 | 13.0 | same-strand | EspA/EspE family |
| 2 | PF10824.10 | 1.0 | 2 | -21.0 | same-strand | Excreted virulence factor EspC, type VII ESX diderm |
| 3 | PF14011.8 | 1.0 | 2 | 300.5 | same-strand | EspG family |
| 4 | PF00004.31 | 1.0 | 2 | 2174.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 5 | PF17866.3 | 1.0 | 2 | 2174.0 | same-strand | AAA lid domain |
++ More..