Result : MgtM
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | MgtM |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica |
| Left | 3979098 |
| Right | 3979136 |
| Strand | - |
| Nucleotide Sequence | TTGGACAGTCACTTTTACGTAAATCATCTGGCAAGTTAA |
| Sequence | MDSHFYVNHLAS |
| Source of smORF | Literature-mining |
| Function | Controls virulence in salmonella in response to acidic environment. Acidic environment promotes ATP synthesis which leads to increased MgtCBR expression. Acts as a sensor for ATP levels. |
| Pubmed ID | 22699622 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1783453 | 1783491 | - | NZ_CP053416.1 | Salmonella bongori |
| 2 | 3965418 | 3965456 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP053416.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00857.22 | 1.0 | 2 | 4830.0 | opposite-strand | Isochorismatase family |
| 2 | PF00122.22 | 1.0 | 2 | 1139.0 | same-strand | E1-E2 ATPase |
| 3 | PF00702.28 | 1.0 | 2 | 1139.0 | same-strand | haloacid dehalogenase-like hydrolase |
| 4 | PF00690.28 | 1.0 | 2 | 1139.0 | same-strand | Cation transporter/ATPase, N-terminus |
| 5 | PF00689.23 | 1.0 | 2 | 1139.0 | same-strand | Cation transporting ATPase, C-terminus |
| 6 | PF02308.18 | 1.0 | 2 | 235.5 | same-strand | MgtC family |
| 7 | PF00892.22 | 1.0 | 2 | 248.5 | opposite-strand | EamA-like transporter family |
| 8 | PF07071.13 | 1.0 | 2 | 2432.0 | same-strand | KDGP aldolase |
++ More..