Result : MgtP
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | MgtP |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica |
| Left | 3978938 |
| Right | 3978988 |
| Strand | - |
| Nucleotide Sequence | ATGTTCATGTTTAAACACGCTTTATTTCCTCCGCCGTTAACACGACGCTAA |
| Sequence | MFMFKHALFPPPLTRR |
| Source of smORF | Literature-mining |
| Function | Increases transcription of the mgtCBR operon (virulence associated) in response to low proline levels. It has 3 consecutive proline codons. |
| Pubmed ID | 22857388 |
| Domain | |
| Functional Category | Leader peptide |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3965258 | 3965308 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1783292 | 1783342 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2947612 | 2947662 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 4 | 3542943 | 3542993 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 5 | 3624380 | 3624430 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 6 | 860756 | 860806 | - | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 7 | 3103503 | 3103553 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 8 | 730761 | 730811 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 3575684 | 3575734 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 10 | 1774271 | 1774321 | - | NZ_CP025799.1 | Dickeya zeae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00122.22 | 0.9 | 9 | 917 | same-strand | E1-E2 ATPase |
| 2 | PF00702.28 | 0.9 | 9 | 917 | same-strand | haloacid dehalogenase-like hydrolase |
| 3 | PF00690.28 | 0.9 | 9 | 917 | same-strand | Cation transporter/ATPase, N-terminus |
| 4 | PF00689.23 | 0.9 | 9 | 917 | same-strand | Cation transporting ATPase, C-terminus |
| 5 | PF02308.18 | 1.0 | 10 | 77.0 | same-strand | MgtC family |
++ More..