Result : SilC
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | SilC |
| NCBI Accession ID | AF493605.1 |
| Organism | Streptococcus pyogenes |
| Left | 2860 |
| Right | 2985 |
| Strand | - |
| Nucleotide Sequence | ATAAACAATAAAAAAACAAAAAATAACTTTTCAACATTATCTGAATCTGAATTACTTAAAGTGATTGGTGGAGATATTTTTAAACTTGTCATAGATCATATTAGTATGAAAGCGAGAAAAAAGTAA |
| Sequence | MNNKKTKNNFSTLSESELLKVIGGDIFKLVIDHISMKARKK |
| Source of smORF | Literature-mining |
| Function | Gene lonked to virulence and lethality in Streptococcal infections. Part of a Com-type quorum sensing system. It contains RKK at C-terminal and a di-glycine motif. |
| Pubmed ID | 12366833 |
| Domain | |
| Functional Category | Quorum sensing |
| Uniprot ID | |
| ORF Length (Amino Acid) | 41 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 524627 | 524752 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 2 | 392145 | 392270 | - | NZ_CP010450.1 | Streptococcus pyogenes |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR594046.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04397.17 | 1.0 | 2 | 1483.0 | opposite-strand | LytTr DNA-binding domain |
| 2 | PF00072.26 | 1.0 | 2 | 1483.0 | opposite-strand | Response regulator receiver domain |
| 3 | PF14501.8 | 1.0 | 2 | 148.0 | opposite-strand | GHKL domain |
| 4 | PF00664.25 | 1.0 | 2 | 1459.0 | same-strand | ABC transporter transmembrane region |
| 5 | PF03412.17 | 1.0 | 2 | 1459.0 | same-strand | Peptidase C39 family |
| 6 | PF00005.29 | 1.0 | 2 | 1459.0 | same-strand | ABC transporter |
++ More..