Result : SHP1358
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | SHP1358 |
| NCBI Accession ID | CP000419.1 |
| Organism | Streptococcus thermophilus LMD-9 |
| Left | 1262689 |
| Right | 1262760 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAAGCAAATTTTACTAACACTTCTTCTTGTCGTATTTGAAGGCATTATCGTTATCGTCGTGGGATAA |
| Sequence | MKKQILLTLLLVVFEGIIVIVVG |
| Source of smORF | Literature-mining |
| Function | Encodes a small hydrophobic quorum sensing peptide in proximity of an Rgg type transcriptional regulator. Imported into cell by Ami oligopeptide transporter. |
| Pubmed ID | 21435032 |
| Domain | |
| Functional Category | Quorum sensing |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1338939 | 1339010 | + | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 2 | 937655 | 937726 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 3 | 1860245 | 1860316 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 4 | 1138471 | 1138542 | + | NZ_LS483403.1 | Streptococcus lutetiensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017581.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01381.24 | 1.0 | 2 | 92.0 | opposite-strand | Helix-turn-helix |
| 2 | PF12844.9 | 1.0 | 2 | 91 | opposite-strand | Helix-turn-helix domain |
++ More..