Result : Pep1

Protein Information

• Protein name: Pep1
• NCBI Accession ID: AE014133.2
• Organism: S.mutans
• Left: 878574
• Right: 878657
• Strand: +
• Nucleotide Sequence: ATGAGTTTAAAGAGTGGTCAAAAAATAAACATATTTTTATTGTTATTTTTGGCTGCTTTTTTATTATTTCTAAATAAAGTGTGA
• Sequence: MSLKSGQKINIFLLLFLAAFLLFLNKV
• Source of smORF: Literature-mining
• Function: downstream of rcrQ gene, upregulated in delta-rcrR-NP mutant, inhibits competence. Also required for thermotolerance at elevated temperatures.
• Pubmed ID: 25135217
• Functional Category: Others
• ORF Length (Amino Acid): 27

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	737433	737516	-	NZ_CP013237.1	Streptococcus mutans
2	1185759	1185833	-	NZ_AP014612.1	Streptococcus troglodytae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP013237.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00072.26	1.0	2	2070.5	same-strand	Response regulator receiver domain
2	PF04607.19	1.0	2	1446.5	same-strand	Region found in RelA / SpoT proteins
3	PF08534.12	1.0	2	119.0	same-strand	Redoxin
4	PF00578.23	1.0	2	119.0	same-strand	AhpC/TSA family
5	PF00664.25	1.0	2	0	same-strand	ABC transporter transmembrane region
6	PF00005.29	1.0	2	872.0	same-strand	ABC transporter
7	PF02463.21	1.0	2	0.0	same-strand	RecF/RecN/SMC N terminal domain
8	PF12802.9	1.0	2	3550.0	same-strand	MarR family
9	PF06508.15	1.0	2	4532.0	opposite-strand	Queuosine biosynthesis protein QueC
10	PF02568.16	1.0	2	4532.0	opposite-strand	Thiamine biosynthesis protein (ThiI)