Protein Information |
Information Type | Description |
---|---|
Protein name | MgtU |
NCBI Accession ID | NC_016856.1 |
Organism | S.enterica Typhimurium 14028S |
Left | 3975021 |
Right | 3975107 |
Strand | - |
Nucleotide Sequence | ATGCAAAAAAGAGGGTTGGACAAAATTTTTTATCAGGTTGTCCTGATAGCAATCATCCTGATTTTACTGACTATCTGGATACGATAA |
Sequence | MQKRGLDKIFYQVVLIAIILILLTIWIR |
Source of smORF | Literature-mining |
Function | Main role is to prevent MgtB proteolysis. It is encoded on the same transcript as MgtR and MgtB. It is also responsible for survival in slc11a1 +/+ macrophages, resistance to oxidative stress and under Mg2+ limitation. |
Pubmed ID | 32753384 |
Domain | |
Functional Category | Others |
Uniprot ID | |
ORF Length (Amino Acid) | 28 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3961341 | 3961427 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 1779374 | 1779460 | - | NZ_CP053416.1 | Salmonella bongori |
3 | 726903 | 726989 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
4 | 2502432 | 2502518 | + | NZ_LR134475.1 | Klebsiella aerogenes |
5 | 88655 | 88741 | - | NC_017553.1 | Pantoea ananatis PA13 |
6 | 84201 | 84287 | + | NZ_CP049116.1 | Pantoea stewartii |
7 | 4046 | 4132 | + | NC_015963.1 | Enterobacter soli |
8 | 2951435 | 2951521 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
9 | 3099645 | 3099731 | - | NZ_CP060111.1 | Klebsiella michiganensis |
10 | 1075446 | 1075526 | + | NZ_CP032489.1 | Arachidicoccus soli |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00122.22 | 0.7 | 7 | 124 | same-strand | E1-E2 ATPase |
2 | PF00702.28 | 0.8 | 8 | 124.0 | same-strand | haloacid dehalogenase-like hydrolase |
3 | PF00690.28 | 0.7 | 7 | 124 | same-strand | Cation transporter/ATPase, N-terminus |
4 | PF00689.23 | 0.7 | 7 | 124 | same-strand | Cation transporting ATPase, C-terminus |
5 | PF02308.18 | 0.6 | 6 | 3012.5 | same-strand | MgtC family |