| Protein name |
Lpt |
| NCBI Accession ID |
KY321384.1 |
| Organism |
L.rhamnosus |
| Left |
196 |
| Right |
285 |
| Strand |
- |
| Nucleotide Sequence |
ATGAATTCATTCGATAAAGCGATCATCGCGCCGCTGCTTGTCGGTGTGTTTCTACTTTTGTTGAAATACGCGCTGGATAACCACAAGTAG |
| Sequence |
MNSFDKAIIAPLLVGVFLLLLKYALDNHK |
| Source of smORF |
Literature-mining |
| Function |
Its a type I toxin.The heterologous expression of the Lpt peptide in E. coli resulted in cell growth inhibition, nucleoid condensation and compromised integrity of the cell membrane. |
| Pubmed ID |
31645607
|
| Domain |
|
| Functional Category |
Toxin type 1 |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
29 |