Protein Information |
Information Type | Description |
---|---|
Protein name | Exodeoxyribonuclease 7 small subunit (EC 3.1.11.6) (Exodeoxyribonuclease VII small subunit) (Exonuclease VII small subunit) |
NCBI Accession ID | CP000923.1 |
Organism | Thermoanaerobacter sp. (strain X514) |
Left | 1559985 |
Right | 1560212 |
Strand | + |
Nucleotide Sequence | ATGAATGAGGAATTGACTTTTGAAGAAGAAATGATGAGATTAGAAGAAATTGTAAATACACTAGAAAAAGGAAATTTAATGTTGGAAGAGTCTTTTAACTTGTTTAAAGAAGGTGTTGAAATTTCTAAAAGATTAGAAAAAAGGTTAAGTGAGGTTGAAGGAAAGATAACCCTTCTCATCAACGAAAATGAAGAAATTGATTTTAAAGAGGAGGAAAAGGATGTTTAA |
Sequence | MNEELTFEEEMMRLEEIVNTLEKGNLMLEESFNLFKEGVEISKRLEKRLSEVEGKITLLINENEEIDFKEEEKDV |
Source of smORF | Swiss-Prot |
Function | Bidirectionally degrades single-stranded DNA into large acid-insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonucleotides. {ECO:0000255|HAMAP-Rule:MF_00337}. |
Pubmed ID | |
Domain | CDD:412547 |
Functional Category | Others |
Uniprot ID | B0K0U9 |
ORF Length (Amino Acid) | 75 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1145727 | 1145954 | + | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
2 | 1261776 | 1262003 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
3 | 1159645 | 1159872 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
4 | 1159278 | 1159505 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
5 | 1131397 | 1131624 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
6 | 1332269 | 1332499 | + | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
7 | 1255113 | 1255343 | + | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
8 | 1323526 | 1323756 | + | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
9 | 1275156 | 1275386 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
10 | 1414714 | 1414911 | + | NZ_CP012502.1 | Bacillus beveridgei |
11 | 2362225 | 2362455 | - | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
12 | 1927048 | 1927233 | - | NZ_CP025197.1 | Acetivibrio saccincola |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03780.15 | 1.0 | 12 | 2514.5 | same-strand | Asp23 family, cell envelope-related function |
2 | PF01029.20 | 1.0 | 12 | 2002.0 | same-strand | NusB family |
3 | PF02882.21 | 0.67 | 8 | 1179.0 | same-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain |
4 | PF00763.25 | 0.67 | 8 | 1179.0 | same-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain |
5 | PF13742.8 | 1.0 | 12 | -8.5 | same-strand | OB-fold nucleic acid binding domain |
6 | PF01336.27 | 1.0 | 12 | -8.5 | same-strand | OB-fold nucleic acid binding domain |
7 | PF00348.19 | 0.92 | 11 | -7 | same-strand | Polyprenyl synthetase |
8 | PF13292.8 | 0.92 | 11 | 2228 | same-strand | 1-deoxy-D-xylulose-5-phosphate synthase |
9 | PF02779.26 | 0.92 | 11 | 2228 | same-strand | Transketolase, pyrimidine binding domain |
10 | PF02780.22 | 0.92 | 11 | 2228 | same-strand | Transketolase, C-terminal domain |
11 | PF01728.21 | 1.0 | 12 | 4094.0 | same-strand | FtsJ-like methyltransferase |
12 | PF01479.27 | 1.0 | 12 | 4094.0 | same-strand | S4 domain |
13 | PF20143.1 | 0.75 | 9 | 4952 | same-strand | ATP-NAD kinase C-terminal domain |