Result : V5QPS4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative antitoxin Rv3098B/RVBD_3098B |
| NCBI Accession ID | CP003248.2 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 3467409 |
| Right | 3467609 |
| Strand | + |
| Nucleotide Sequence | ATGACCGCGACCATCGGCTTCCGACCTACTGAAAAAGACGAGCAGATCATCAACGCCGCAATGCGCAGCGGCGAGCGCAAGAGCGACGTCATCCGGCGGGCACTGCAGCTGCTCGAACGGGAAGTGTGGATCAAGCAAGCTCGCACCGACGCTGAGCGACTTCGAGACGAGGATGTCTCCACTGAACCGGACGCGTGGTGA |
| Sequence | MTATIGFRPTEKDEQIINAAMRSGERKSDVIRRALQLLEREVWIKQARTDAERLRDEDVSTEPDAW |
| Source of smORF | Swiss-Prot |
| Function | Putative antitoxin component of a possible type II toxin-antitoxin (TA) system. May neutralize the effect of cognate toxin Rv3098A/RVBD_3098A. {ECO:0000305}. |
| Pubmed ID | 9634230 |
| Domain | |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | V5QPS4 |
| ORF Length (Amino Acid) | 66 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3467412 | 3467612 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 699972 | 700172 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 3 | 3531610 | 3531771 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 4 | 5275738 | 5275938 | - | NZ_CP016353.1 | Prauserella marina |
| 5 | 1339888 | 1340088 | + | NC_015576.1 | Mycolicibacter sinensis |
| 6 | 4298715 | 4298915 | - | NC_015635.1 | Microlunatus phosphovorus NM-1 |
| 7 | 2445470 | 2445667 | + | NZ_CP025198.1 | Acidipropionibacterium virtanenii |
| 8 | 3183427 | 3183627 | - | NZ_CP047156.1 | Epidermidibacterium keratini |
| 9 | 1890309 | 1890503 | + | NC_013530.1 | Xylanimonas cellulosilytica DSM 15894 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02452.19 | 0.89 | 8 | -3 | same-strand | PemK-like, MazF-like toxin of type II toxin-antitoxin system |
++ More..