Result : U3PVA8
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein IroK (3-hydroxypropionic acid resistance peptide) |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 2668006 |
| Right | 2668071 |
| Strand | - |
| Nucleotide Sequence | ATGAAGCCGGCATTACGCGATTTCATCGCCATTGTGCAGGAACGTTTGGCAAGCGTAACGGCATAA |
| Sequence | MKPALRDFIAIVQERLASVTA |
| Source of smORF | Swiss-Prot |
| Function | Possible increased expression of this protein (due to mutations upstream of the start codon) is proposed to be responsible for resistance to 3-hydroxypropionic acid (3-HP). {ECO:0000269|Pubmed:22161628}. |
| Pubmed ID | 9278503 22161628 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | U3PVA8 |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1076181 | 1076246 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 2 | 2668006 | 2668071 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3388642 | 3388707 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2652858 | 2652923 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12832.9 | 1.0 | 3 | 160.0 | same-strand | MFS 1 like family |
| 2 | PF01306.21 | 1.0 | 3 | 160.0 | same-strand | LacY proton/sugar symporter |
| 3 | PF07690.18 | 1.0 | 3 | 160.0 | same-strand | Major Facilitator Superfamily |
| 4 | PF00874.22 | 1.0 | 3 | 1291.0 | opposite-strand | PRD domain |
| 5 | PF00326.23 | 1.0 | 3 | 2762.0 | opposite-strand | Prolyl oligopeptidase family |
| 6 | PF00459.27 | 1.0 | 3 | 3761.0 | opposite-strand | Inositol monophosphatase family |
| 7 | PF00588.21 | 1.0 | 3 | 4683.0 | same-strand | SpoU rRNA Methylase family |
| 8 | PF00848.21 | 0.67 | 2 | 961 | opposite-strand | Ring hydroxylating alpha subunit (catalytic domain) |
| 9 | PF00355.28 | 0.67 | 2 | 1899.0 | opposite-strand | Rieske [2Fe-2S] domain |
| 10 | PF00866.20 | 0.67 | 2 | 2319 | opposite-strand | Ring hydroxylating beta subunit |
| 11 | PF13806.8 | 0.67 | 2 | 2837 | opposite-strand | Rieske-like [2Fe-2S] domain |
| 12 | PF00106.27 | 0.67 | 2 | 3154 | opposite-strand | short chain dehydrogenase |
| 13 | PF13561.8 | 0.67 | 2 | 3154 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
++ More..