Result : Q9ZCM7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein RP697 |
| NCBI Accession ID | AJ235272.1 |
| Organism | Rickettsia prowazekii (strain Madrid E) |
| Left | 275038 |
| Right | 275286 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAATTTATTAAAGATTTTATTAATTATAGCTTTCGCAAACCCAGTATTTGCTTCATCAATGCAAATGCCTGACCCAGCTTCAGTAACAACAACTCAAATACATGCTATGAGTACTAACGCTCAACAAGATTGGATTGCTAGTTTAACAGCAAATCAGTATAATATGTTAAGTCCTGATGTCCAAAAGTGGGTAATGGAGAATACTACTGATGCTCAAAAACAAGCTTTAGGGATTAATCAATAA |
| Sequence | MKNLLKILLIIAFANPVFASSMQMPDPASVTTTQIHAMSTNAQQDWIASLTANQYNMLSPDVQKWVMENTTDAQKQALGINQ |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam10880. Profile Description: Protein of unknown function (DUF2673). This family of proteins with unknown function appears to be restricted to Rickettsiae spp. |
| Pubmed ID | 9823893 |
| Domain | CDD:313953 |
| Functional Category | Others |
| Uniprot ID | Q9ZCM7 |
| ORF Length (Amino Acid) | 82 |
++ More..
| Conservation Analysis |
No. of Species: 11
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 867998 | 868246 | + | NC_017049.1 | Rickettsia prowazekii str. Chernikova |
| 2 | 879605 | 879853 | + | NC_017066.1 | Rickettsia typhi str. TH1527 |
| 3 | 1070130 | 1070378 | + | NZ_AP019563.1 | Rickettsia asiatica |
| 4 | 441781 | 442029 | - | NC_017058.1 | Rickettsia australis str. Cutlack |
| 5 | 15004 | 15252 | + | NZ_LN794217.1 | Rickettsia monacensis |
| 6 | 970187 | 970435 | + | NC_009881.1 | Rickettsia akari str. Hartford |
| 7 | 1011788 | 1012036 | + | NZ_AP019864.1 | Rickettsia heilongjiangensis |
| 8 | 994956 | 995204 | + | NC_003103.1 | Rickettsia conorii str. Malish 7 |
| 9 | 1021343 | 1021591 | - | NC_016639.1 | Rickettsia slovaca 13-B |
| 10 | 1001897 | 1002145 | + | NC_010263.3 | Rickettsia rickettsii str. Iowa |
| 11 | 923602 | 923844 | + | NC_016929.1 | Rickettsia canadensis str. CA410 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017049.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13302.9 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 2 | PF00583.27 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) family |
| 3 | PF13420.9 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 4 | PF06508.15 | 1.0 | 11 | 2925 | opposite-strand | Queuosine biosynthesis protein QueC |
| 5 | PF00664.25 | 1.0 | 11 | 303 | same-strand | ABC transporter transmembrane region |
| 6 | PF00005.29 | 1.0 | 11 | 1480.5 | same-strand | ABC transporter |
| 7 | PF02463.21 | 1.0 | 11 | 303 | same-strand | RecF/RecN/SMC N terminal domain |
| 8 | PF07690.18 | 0.82 | 9 | 659 | same-strand | Major Facilitator Superfamily |
| 9 | PF12704.9 | 1.0 | 11 | 1845 | same-strand | MacB-like periplasmic core domain |
| 10 | PF02687.23 | 1.0 | 11 | 1845 | same-strand | FtsX-like permease family |
| 11 | PF01595.22 | 0.73 | 8 | 6002.0 | same-strand | Cyclin M transmembrane N-terminal domain |
| 12 | PF03471.19 | 0.73 | 8 | 6002.0 | same-strand | Transporter associated domain |
| 13 | PF00571.30 | 0.73 | 8 | 6002.0 | same-strand | CBS domain |
++ More..