Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein RP697 |
NCBI Accession ID | AJ235272.1 |
Organism | Rickettsia prowazekii (strain Madrid E) |
Left | 275038 |
Right | 275286 |
Strand | + |
Nucleotide Sequence | ATGAAAAATTTATTAAAGATTTTATTAATTATAGCTTTCGCAAACCCAGTATTTGCTTCATCAATGCAAATGCCTGACCCAGCTTCAGTAACAACAACTCAAATACATGCTATGAGTACTAACGCTCAACAAGATTGGATTGCTAGTTTAACAGCAAATCAGTATAATATGTTAAGTCCTGATGTCCAAAAGTGGGTAATGGAGAATACTACTGATGCTCAAAAACAAGCTTTAGGGATTAATCAATAA |
Sequence | MKNLLKILLIIAFANPVFASSMQMPDPASVTTTQIHAMSTNAQQDWIASLTANQYNMLSPDVQKWVMENTTDAQKQALGINQ |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of pfam10880. Profile Description: Protein of unknown function (DUF2673). This family of proteins with unknown function appears to be restricted to Rickettsiae spp. |
Pubmed ID | 9823893 |
Domain | CDD:313953 |
Functional Category | Others |
Uniprot ID | Q9ZCM7 |
ORF Length (Amino Acid) | 82 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 867998 | 868246 | + | NC_017049.1 | Rickettsia prowazekii str. Chernikova |
2 | 879605 | 879853 | + | NC_017066.1 | Rickettsia typhi str. TH1527 |
3 | 1070130 | 1070378 | + | NZ_AP019563.1 | Rickettsia asiatica |
4 | 441781 | 442029 | - | NC_017058.1 | Rickettsia australis str. Cutlack |
5 | 15004 | 15252 | + | NZ_LN794217.1 | Rickettsia monacensis |
6 | 970187 | 970435 | + | NC_009881.1 | Rickettsia akari str. Hartford |
7 | 1011788 | 1012036 | + | NZ_AP019864.1 | Rickettsia heilongjiangensis |
8 | 994956 | 995204 | + | NC_003103.1 | Rickettsia conorii str. Malish 7 |
9 | 1021343 | 1021591 | - | NC_016639.1 | Rickettsia slovaca 13-B |
10 | 1001897 | 1002145 | + | NC_010263.3 | Rickettsia rickettsii str. Iowa |
11 | 923602 | 923844 | + | NC_016929.1 | Rickettsia canadensis str. CA410 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF13302.9 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) domain |
2 | PF00583.27 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) family |
3 | PF13420.9 | 0.73 | 8 | 3619.0 | opposite-strand | Acetyltransferase (GNAT) domain |
4 | PF06508.15 | 1.0 | 11 | 2925 | opposite-strand | Queuosine biosynthesis protein QueC |
5 | PF00664.25 | 1.0 | 11 | 303 | same-strand | ABC transporter transmembrane region |
6 | PF00005.29 | 1.0 | 11 | 1480.5 | same-strand | ABC transporter |
7 | PF02463.21 | 1.0 | 11 | 303 | same-strand | RecF/RecN/SMC N terminal domain |
8 | PF07690.18 | 0.82 | 9 | 659 | same-strand | Major Facilitator Superfamily |
9 | PF12704.9 | 1.0 | 11 | 1845 | same-strand | MacB-like periplasmic core domain |
10 | PF02687.23 | 1.0 | 11 | 1845 | same-strand | FtsX-like permease family |
11 | PF01595.22 | 0.73 | 8 | 6002.0 | same-strand | Cyclin M transmembrane N-terminal domain |
12 | PF03471.19 | 0.73 | 8 | 6002.0 | same-strand | Transporter associated domain |
13 | PF00571.30 | 0.73 | 8 | 6002.0 | same-strand | CBS domain |