Result : Q9WYZ6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | RNA-binding protein Hfq |
| NCBI Accession ID | AE000512.1 |
| Organism | Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) |
| Left | 551311 |
| Right | 551589 |
| Strand | + |
| Nucleotide Sequence | TTGGCCTTGGCGGAGAAGTTCAACCTTCAGGACAGGTTTCTGAATCATCTCAGGGTTAACAAGATCGAAGTGAAGGTGTATCTGGTGAACGGTTTTCAGACAAAGGGATTCATCAGATCTTTCGACAGCTACACGGTCTTGCTGGAGAGCGGAAACCAACAGAGCCTCATCTACAAACACGCGATCAGCACGATCATTCCTTCTTCTTATGTGATGCTGATGCCAAAGAAACAGGAAACAGCACAGGAGGCTGAGACCTCTGAAAACGAGGGATCTTGA |
| Sequence | MALAEKFNLQDRFLNHLRVNKIEVKVYLVNGFQTKGFIRSFDSYTVLLESGNQQSLIYKHAISTIIPSSYVMLMPKKQETAQEAETSENEGS |
| Source of smORF | Swiss-Prot |
| Function | RNA chaperone that binds small regulatory RNA (sRNAs) and mRNAs to facilitate mRNA translational regulation in response to envelope stress, environmental stress and changes in metabolite concentrations. Also binds with high specificity to tRNAs. {ECO:0000255|HAMAP-Rule:MF_00436}. |
| Pubmed ID | 10360571 |
| Domain | CDD:412267 |
| Functional Category | RNA-binding |
| Uniprot ID | Q9WYZ6 |
| ORF Length (Amino Acid) | 92 |
++ More..
| Conservation Analysis |
No. of Species: 37
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 394026 | 394304 | - | NC_023151.1 | Thermotoga maritima MSB8 |
| 2 | 305534 | 305812 | + | NC_013642.1 | Thermotoga naphthophila RKU-10 |
| 3 | 383901 | 384179 | - | NC_009486.1 | Thermotoga petrophila RKU-1 |
| 4 | 137332 | 137604 | - | NC_011978.1 | Thermotoga neapolitana DSM 4359 |
| 5 | 1952156 | 1952434 | + | NC_022795.1 | Pseudothermotoga hypogea DSM 11164 = NBRC 106472 |
| 6 | 1012334 | 1012612 | + | NZ_AP014509.1 | Thermotoga caldifontis AZM44c09 |
| 7 | 1748513 | 1748740 | - | NZ_CP007389.1 | Thermosipho melanesiensis |
| 8 | 798398 | 798631 | + | NC_009828.1 | Pseudothermotoga lettingae TMO |
| 9 | 791563 | 791796 | + | NC_022792.1 | Pseudothermotoga elfii DSM 9442 = NBRC 107921 |
| 10 | 2070710 | 2070952 | + | NZ_CP011232.1 | Kosmotoga pacifica |
| 11 | 1763487 | 1763714 | - | NZ_LN824141.1 | Defluviitoga tunisiensis |
| 12 | 1117072 | 1117338 | + | NC_016751.1 | Marinitoga piezophila KA3 |
| 13 | 1488908 | 1489150 | + | NC_010003.1 | Petrotoga mobilis SJ95 |
| 14 | 1565782 | 1566015 | + | NZ_AP018712.1 | Tepiditoga spiralis |
| 15 | 1409762 | 1410010 | - | NZ_CP034118.1 | Staphylospora marina |
| 16 | 1844183 | 1844422 | - | NC_019897.1 | Thermobacillus composti KWC4 |
| 17 | 1928123 | 1928359 | - | NC_013385.1 | Ammonifex degensii KC4 |
| 18 | 1617316 | 1617555 | - | NZ_CP024955.1 | Kyrpidia spormannii |
| 19 | 1643337 | 1643576 | + | NC_014098.1 | Kyrpidia tusciae DSM 2912 |
| 20 | 1024491 | 1024727 | + | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 21 | 34538 | 34768 | + | NZ_CP023671.1 | Clostridium septicum |
| 22 | 2198881 | 2199132 | - | NC_018017.1 | Desulfitobacterium dehalogenans ATCC 51507 |
| 23 | 747092 | 747331 | + | NZ_CP025286.1 | Ethanoligenens harbinense YUAN-3 |
| 24 | 1072182 | 1072406 | + | NZ_CP017237.1 | Moorella thermoacetica |
| 25 | 2210059 | 2210292 | - | NZ_CP020559.1 | Clostridium formicaceticum |
| 26 | 1377587 | 1377841 | + | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 27 | 1547196 | 1547456 | + | NC_013205.1 | Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 |
| 28 | 757553 | 757777 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 29 | 2894711 | 2894956 | - | NZ_CP043998.1 | Clostridium diolis |
| 30 | 3011337 | 3011576 | - | NZ_CP019699.1 | Novibacillus thermophilus |
| 31 | 1373713 | 1373964 | + | NZ_HG917868.1 | Clostridium bornimense |
| 32 | 1294655 | 1294900 | - | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 33 | 1156090 | 1156347 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 34 | 1995665 | 1995916 | + | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 35 | 1264242 | 1264475 | + | NC_017033.1 | Frateuria aurantia DSM 6220 |
| 36 | 1011253 | 1011495 | + | NZ_CP038018.1 | Eikenella exigua |
| 37 | 1442112 | 1442372 | - | NZ_CP040882.1 | Sutterella faecalis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_023151.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01715.19 | 0.89 | 33 | 38 | same-strand | IPP transferase |
++ More..