Result : Q9PK06
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0235 protein TC_0667 |
| NCBI Accession ID | AE002160.2 |
| Organism | Chlamydia muridarum (strain MoPn / Nigg) |
| Left | 796479 |
| Right | 796781 |
| Strand | - |
| Nucleotide Sequence | TTGTTAGAAGGCTTTTGGGTTTTAGAGATTAGAGTTACTACAAAGGCGCGAGAAAATAAGGTCGTAAGCTTGGAAGATGGTATACTAAGGGTCCGGGTGACCGAGGCGCCAGAAAGGGGCAAGGCTAATGATGCCGTTGTAGCATTGCTTGCAAAATTTTTGTCTATTCCTAAGAACGATGTCACTTTGATAGCGGGAGAGGCTTCTCGTAGGAAGAAGGTATTATTACCTAGAGCTATTAAAGCCTTTTTATTTGAGCAATTTCCCCAAACATCTTCCCCTGATGCAGGGAAAAAATGTTAG |
| Sequence | MLEGFWVLEIRVTTKARENKVVSLEDGILRVRVTEAPERGKANDAVVALLAKFLSIPKNDVTLIAGEASRRKKVLLPRAIKAFLFEQFPQTSSPDAGKKC |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00811. Profile Description: Uncharacterized ACR, YggU family COG1872. hypothetical protein; Validated |
| Pubmed ID | 10684935 |
| Domain | CDD:412584 |
| Functional Category | Others |
| Uniprot ID | Q9PK06 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 796479 | 796781 | - | NC_002620.2 | Chlamydia muridarum str. Nigg |
| 2 | 442625 | 442927 | - | NC_000117.1 | Chlamydia trachomatis D/UW-3/CX |
| 3 | 489287 | 489589 | - | NZ_LS398098.1 | Chlamydia suis |
| 4 | 263124 | 263375 | + | NC_003361.3 | Chlamydia caviae GPIC |
| 5 | 902814 | 903071 | - | NC_007899.1 | Chlamydia felis Fe/C-56 |
| 6 | 575138 | 575410 | - | NC_005043.1 | Chlamydia pneumoniae TW-183 |
| 7 | 264016 | 264267 | + | NC_017287.1 | Chlamydia psittaci 6BC |
| 8 | 689656 | 689922 | + | NZ_CP015840.1 | Chlamydia gallinacea 08-1274/3 |
| 9 | 255806 | 256075 | + | NC_022439.1 | Chlamydia pecorum PV3056/3 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007899.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03690.15 | 0.67 | 6 | 4140.0 | same-strand | Uncharacterised protein family (UPF0160) |
| 2 | PF06727.13 | 1.0 | 9 | 2785 | same-strand | Protein of unknown function (DUF1207) |
| 3 | PF00155.23 | 1.0 | 9 | 1037 | opposite-strand | Aminotransferase class I and II |
| 4 | PF04392.14 | 1.0 | 9 | -3 | opposite-strand | ABC transporter substrate binding protein |
| 5 | PF00587.27 | 1.0 | 9 | 2568 | opposite-strand | tRNA synthetase class II core domain (G, H, P, S and T) |
| 6 | PF04073.17 | 1.0 | 9 | 2568 | opposite-strand | Aminoacyl-tRNA editing domain |
| 7 | PF03129.22 | 1.0 | 9 | 2568 | opposite-strand | Anticodon binding domain |
| 8 | PF01628.23 | 0.67 | 6 | 4389.0 | opposite-strand | HrcA protein C terminal domain |
++ More..