| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Glutamine synthetase translation inhibitor |
| NCBI Accession ID | AJ278117.1 |
| Organism | Rhizobium leguminosarum |
| Left | 124 |
| Right | 315 |
| Strand | + |
| Nucleotide Sequence | ATGCCCACCGGTTTCCACCGTGAATCCGCAACGATCTACCAGTTTCCCGTCAAGGCGATACGCAACGCCAACCGGTTCGAACGCGCCCGCCTGATGGAGCGCGAGGCAGCCGAAGTCTGCGATGCCGCGCTCGACAGCTGCTGGTACCATGACGAGGCGGTTCGCGAATCCGACCGGCCGACGAAGTCCTGA |
| Sequence | MPTGFHRESATIYQFPVKAIRNANRFERARLMEREAAEVCDAALDSCWYHDEAVRESDRPTKS |
| Source of smORF | Swiss-Prot |
| Function | Inhibits the synthesis of glutamine synthetase II. |
| Pubmed ID | 10931338 |
| Domain | CDD:371303 |
| Functional Category | Others |
| Uniprot ID | Q9K4V1 |
| ORF Length (Amino Acid) | 63 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3690379 | 3690570 | - | NZ_CP071678.1 | Rhizobium ruizarguesonis |
| 2 | 3996600 | 3996791 | + | NZ_CP054021.1 | Rhizobium indicum |
| 3 | 3207785 | 3207976 | - | NZ_CP071612.1 | Rhizobium bangladeshense |
| 4 | 3292316 | 3292507 | - | NZ_CP013500.1 | Rhizobium esperanzae |
| 5 | 3306073 | 3306264 | - | NZ_CP071604.1 | Rhizobium binae |
| 6 | 3166044 | 3166235 | - | NZ_CP020906.1 | Rhizobium etli |
| 7 | 2942501 | 2942692 | - | NZ_CP034998.1 | Rhizobium acidisoli |
| 8 | 606391 | 606582 | - | NZ_CP071454.1 | Rhizobium lentis |
| 9 | 1210293 | 1210481 | + | NZ_CP054027.1 | Rhizobium hidalgonense |
| 10 | 3308093 | 3308284 | - | NZ_CP013532.1 | Rhizobium phaseoli |
| 11 | 615233 | 615427 | - | NZ_CP013110.1 | Sinorhizobium americanum |
| 12 | 1699907 | 1700101 | + | NZ_CP029452.1 | Sinorhizobium fredii CCBAU 25509 |
| 13 | 2023690 | 2023887 | - | NZ_CP053856.1 | Rhizobium pusense |
| 14 | 2754267 | 2754464 | - | NZ_HG938353.1 | Neorhizobium galegae bv. orientalis str. HAMBI 540 |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 0.86 | 12 | 3675 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF12911.9 | 0.71 | 10 | 3681.0 | opposite-strand | N-terminal TM domain of oligopeptide transport permease C |
| 3 | PF00005.29 | 0.93 | 13 | 2255 | opposite-strand | ABC transporter |
| 4 | PF08352.14 | 0.71 | 10 | 2069.0 | opposite-strand | Oligopeptide/dipeptide transporter, C-terminal region |
| 5 | PF00294.26 | 0.71 | 10 | 84.0 | opposite-strand | pfkB family carbohydrate kinase |
| 6 | PF03951.21 | 1.0 | 14 | 432.5 | opposite-strand | Glutamine synthetase, beta-Grasp domain |
| 7 | PF13439.8 | 0.71 | 10 | 1710.5 | opposite-strand | Glycosyltransferase Family 4 |
| 8 | PF13579.8 | 0.71 | 10 | 1710.5 | opposite-strand | Glycosyl transferase 4-like domain |
| 9 | PF01926.25 | 0.71 | 10 | 4681.0 | same-strand | 50S ribosome-binding GTPase |
| 10 | PF14714.8 | 0.71 | 10 | 4681.0 | same-strand | KH-domain-like of EngA bacterial GTPase enzymes, C-terminal |
| 11 | PF02421.20 | 0.71 | 10 | 4681.0 | same-strand | Ferrous iron transport protein B |
| 12 | PF00009.29 | 0.71 | 10 | 4681.0 | same-strand | Elongation factor Tu GTP binding domain |