Result : Q9I3N4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Heme exporter protein D (Cytochrome c-type biogenesis protein CcmD) |
| NCBI Accession ID | AE004091.2 |
| Organism | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| Left | 1604426 |
| Right | 1604602 |
| Strand | + |
| Nucleotide Sequence | ATGAGCTTCGAATCGTTCGGCGACTTCCTCGCCATGGGCCATCACGGTCCCTACGTCTGGTCGGCCTACGGCATCAGCCTGCTGGTGCTGGCGATCAATGTCGCCGAGCCGCTGCTGGCCCGGCGCCGCTACCTGCAAGAAGAGGCGCGTCGTCTGCGCCGGGAGGCCCAGCAGTGA |
| Sequence | MSFESFGDFLAMGHHGPYVWSAYGISLLVLAINVAEPLLARRRYLQEEARRLRREAQQ |
| Source of smORF | Swiss-Prot |
| Function | Required for the export of heme to the periplasm for the biogenesis of c-type cytochromes. {ECO:0000305}. |
| Pubmed ID | 10984043 |
| Domain | CDD:416290 |
| Functional Category | Others |
| Uniprot ID | Q9I3N4 |
| ORF Length (Amino Acid) | 58 |
++ More..
| Conservation Analysis |
No. of Species: 58
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1604426 | 1604602 | + | NC_002516.2 | Pseudomonas aeruginosa PAO1 |
| 2 | 1692696 | 1692872 | + | NZ_CP047698.1 | Pseudomonas knackmussii |
| 3 | 1962199 | 1962375 | + | NZ_CP014158.1 | Pseudomonas citronellolis |
| 4 | 4171589 | 4171765 | - | NZ_CP046621.1 | Pseudomonas alkylphenolica |
| 5 | 5151764 | 5151940 | + | NZ_CP031146.1 | Pseudomonas plecoglossicida |
| 6 | 4653537 | 4653713 | - | NZ_CP048833.1 | Pseudomonas multiresinivorans |
| 7 | 1675023 | 1675199 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 8 | 4170832 | 4171008 | - | NZ_CP022562.1 | Pseudomonas monteilii |
| 9 | 4950593 | 4950769 | - | NZ_CP035088.1 | Pseudomonas viciae |
| 10 | 1782540 | 1782716 | + | NZ_CP035088.1 | Pseudomonas viciae |
| 11 | 1816689 | 1816865 | + | NZ_CP034725.1 | Pseudomonas brassicacearum |
| 12 | 4058829 | 4059005 | - | NC_008027.1 | Pseudomonas entomophila L48 |
| 13 | 1744861 | 1745037 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 14 | 3218934 | 3219110 | - | NZ_CP009365.1 | Pseudomonas soli |
| 15 | 2368031 | 2368207 | - | NZ_CP048810.1 | Pseudomonas bijieensis |
| 16 | 1850827 | 1851003 | + | NZ_CP051487.1 | Pseudomonas umsongensis |
| 17 | 1790778 | 1790954 | + | NZ_CP062252.1 | Pseudomonas allokribbensis |
| 18 | 1817217 | 1817393 | + | NZ_CP043311.1 | Pseudomonas lalkuanensis |
| 19 | 4605885 | 4606061 | - | NZ_CP056030.1 | Pseudomonas eucalypticola |
| 20 | 2118228 | 2118404 | + | NZ_CP054205.1 | Pseudomonas rhodesiae |
| 21 | 1823429 | 1823605 | + | NZ_CP071706.1 | Pseudomonas donghuensis |
| 22 | 1831371 | 1831547 | + | NZ_CP027723.1 | Pseudomonas orientalis |
| 23 | 2067818 | 2067994 | + | NZ_CP027756.1 | Pseudomonas synxantha |
| 24 | 5386094 | 5386270 | + | NZ_CP014262.1 | Pseudomonas corrugata |
| 25 | 4876109 | 4876285 | - | NZ_CP014870.1 | Pseudomonas silesiensis |
| 26 | 1609204 | 1609380 | + | NZ_CP012400.2 | Pseudomonas yamanorum |
| 27 | 1970188 | 1970364 | + | NZ_CP018420.1 | Pseudomonas veronii |
| 28 | 4154010 | 4154186 | - | NZ_CP049044.1 | Pseudomonas psychrophila |
| 29 | 185078 | 185254 | - | NZ_CP070505.1 | Pseudomonas toyotomiensis |
| 30 | 1867995 | 1868171 | + | NZ_CP023272.1 | Pseudomonas lurida |
| 31 | 1914363 | 1914539 | + | NZ_CP010896.1 | Pseudomonas simiae |
| 32 | 1784724 | 1784900 | + | NZ_LR215729.2 | Pseudomonas marincola |
| 33 | 5752220 | 5752396 | + | NZ_CP005960.1 | Pseudomonas mandelii JR-1 |
| 34 | 1846243 | 1846419 | - | NZ_CP005960.1 | Pseudomonas mandelii JR-1 |
| 35 | 4338129 | 4338305 | - | NZ_CP070503.1 | Pseudomonas atacamensis |
| 36 | 1854281 | 1854457 | + | NZ_CP029608.1 | Pseudomonas kribbensis |
| 37 | 1835794 | 1835970 | + | NZ_CP062253.1 | Pseudomonas gozinkensis |
| 38 | 2294662 | 2294838 | + | NZ_CP060009.1 | Pseudomonas sediminis |
| 39 | 2824832 | 2825008 | - | NZ_CP012676.1 | Pseudomonas versuta |
| 40 | 4338282 | 4338458 | - | NZ_AP014862.1 | Pseudomonas furukawaii |
| 41 | 3106614 | 3106790 | - | NZ_CP062158.2 | Pseudomonas lundensis |
| 42 | 575778 | 575954 | + | NZ_CP009533.1 | Pseudomonas rhizosphaerae |
| 43 | 3958168 | 3958344 | - | NZ_CP007039.1 | Pseudomonas cichorii JBC1 |
| 44 | 2104122 | 2104298 | + | NZ_CP013124.1 | Pseudomonas mendocina S5.2 |
| 45 | 3725769 | 3725945 | + | NZ_CP014205.2 | Pseudomonas glycinae |
| 46 | 1906366 | 1906542 | + | NZ_LS999205.1 | Pseudomonas protegens CHA0 |
| 47 | 4093021 | 4093197 | - | NC_004578.1 | Pseudomonas syringae pv. tomato str. DC3000 |
| 48 | 2182490 | 2182666 | + | NZ_CP067022.1 | Pseudomonas cannabina pv. alisalensis |
| 49 | 3931722 | 3931898 | - | NZ_CP042804.1 | Pseudomonas amygdali pv. tabaci str. ATCC 11528 |
| 50 | 590493 | 590669 | - | NZ_CP012362.1 | Oblitimonas alkaliphila |
| 51 | 3356247 | 3356423 | - | NZ_CP068551.1 | Pseudomonas khazarica |
| 52 | 1139832 | 1140020 | + | NC_020888.1 | Thalassolituus oleivorans MIL-1 |
| 53 | 1837395 | 1837571 | + | NZ_CP061079.1 | Pseudomonas chlororaphis |
| 54 | 4452447 | 4452626 | + | NZ_CP022684.1 | Ketobacter alkanivorans |
| 55 | 676679 | 676858 | + | NZ_AP014545.1 | Amphritea japonica ATCC BAA-1530 |
| 56 | 2460629 | 2460808 | + | NZ_CP048878.1 | Spartinivicinus ruber |
| 57 | 977411 | 977590 | + | NZ_CP015839.1 | Marinobacterium aestuarii |
| 58 | 1580885 | 1581094 | + | NZ_CP031093.1 | Hydrocarboniclastica marina |
| 59 | 1688622 | 1688819 | + | NC_018691.1 | Alcanivorax dieselolei B5 |
| 60 | 4046373 | 4046549 | - | NZ_CP068034.2 | Pseudomonas syringae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002516.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02120.18 | 0.97 | 56 | 2335.0 | opposite-strand | Flagellar hook-length control protein FliK |
| 2 | PF00005.29 | 1.0 | 58 | 1496.0 | same-strand | ABC transporter |
| 3 | PF03379.15 | 1.0 | 58 | 831.0 | same-strand | CcmB protein |
| 4 | PF01061.26 | 0.93 | 54 | 831.0 | same-strand | ABC-2 type transporter |
| 5 | PF01578.22 | 0.98 | 57 | 85 | same-strand | Cytochrome C assembly protein |
| 6 | PF03100.17 | 1.0 | 58 | -3.0 | same-strand | CcmE |
| 7 | PF16327.7 | 0.97 | 56 | 456.0 | same-strand | Cytochrome c-type biogenesis protein CcmF C-terminal |
| 8 | PF08534.12 | 0.97 | 56 | 2441 | same-strand | Redoxin |
| 9 | PF00578.23 | 0.97 | 56 | 2441 | same-strand | AhpC/TSA family |
| 10 | PF13098.8 | 0.86 | 50 | 2441 | same-strand | Thioredoxin-like domain |
| 11 | PF03918.16 | 0.97 | 56 | 2974.0 | same-strand | Cytochrome C biogenesis protein |
++ More..