Protein Information |
Information Type | Description |
---|---|
Protein name | Cell division protein ZapA (Z ring-associated protein ZapA) |
NCBI Accession ID | AE004439.1 |
Organism | Pasteurella multocida (strain Pm70) |
Left | 1932292 |
Right | 1932594 |
Strand | - |
Nucleotide Sequence | ATGTCGTCTAAAAGTATTGAGTTACCTGTATTAGGGCAGGTTTTACGTTTAAATTGTCCAGAAGAGCAGCATGAAGCATTAAAACAAGCCGCAAGAGAGCTTGATTTACGCGTCAGTGAAATGAAAGAACGCACAGGGATTTTACAGTTAGAACGCGTGTTGTCGATTGTTGCGTTAAATTTAAGCTATGAATTATTACAAGCACAGCAAAAGACCACCTCAATTGAGGCGTTATTACAGCACCGCATTCAACAACTTGATCATTCTCTTGAAAGCATTTTAACGCAAAAAGTGAACAATTAA |
Sequence | MSSKSIELPVLGQVLRLNCPEEQHEALKQAARELDLRVSEMKERTGILQLERVLSIVALNLSYELLQAQQKTTSIEALLQHRIQQLDHSLESILTQKVNN |
Source of smORF | Swiss-Prot |
Function | Activator of cell division through the inhibition of FtsZ GTPase activity, therefore promoting FtsZ assembly into bundles of protofilaments necessary for the formation of the division Z ring. It is recruited early at mid-cell but it is not essential for cell division (By similarity). {ECO:0000250}. |
Pubmed ID | 11248100 |
Domain | CDD:412769 |
Functional Category | Others |
Uniprot ID | Q9CKA3 |
ORF Length (Amino Acid) | 100 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 683055 | 683357 | - | NZ_CP028926.1 | Pasteurella multocida |
2 | 2171167 | 2171469 | + | NZ_LT906448.1 | Pasteurella dagmatis |
3 | 1109059 | 1109367 | + | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
4 | 59834 | 60136 | - | NZ_LR134167.1 | Avibacterium volantium |
5 | 151061 | 151366 | + | NZ_LS483443.1 | Aggregatibacter segnis ATCC 33393 |
6 | 226743 | 227045 | - | NZ_CP016605.1 | Bisgaardia hudsonensis |
7 | 46114 | 46437 | - | NZ_CP015031.1 | Basfia succiniciproducens |
8 | 441358 | 441681 | - | NC_006300.1 | [Mannheimia] succiniciproducens MBEL55E |
9 | 1385478 | 1385777 | - | NZ_CP018804.1 | Histophilus somni |
10 | 1036803 | 1037114 | + | NZ_LR134510.1 | Actinobacillus delphinicola |
11 | 1215428 | 1215724 | - | NZ_CP040863.1 | Rodentibacter heylii |
12 | 242824 | 243114 | - | NZ_LT906463.1 | Haemophilus pittmaniae |
13 | 143308 | 143610 | - | NZ_CP009610.1 | Haemophilus influenzae |
14 | 153392 | 153694 | - | NZ_LS483429.1 | Haemophilus aegyptius |
15 | 117013 | 117315 | - | NZ_LS483458.1 | Haemophilus haemolyticus |
16 | 132023 | 132343 | - | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
17 | 295202 | 295522 | + | NZ_CP015425.1 | [Haemophilus] ducreyi |
18 | 1149047 | 1149376 | - | NC_011852.1 | Glaesserella parasuis SH0165 |
19 | 2193299 | 2193607 | - | NZ_CP029206.1 | Actinobacillus porcitonsillarum |
20 | 1459990 | 1460310 | + | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
21 | 1449749 | 1450069 | + | NZ_CP007715.1 | Actinobacillus equuli subsp. equuli |
22 | 4511 | 4840 | + | NZ_CP015029.1 | Frederiksenia canicola |
23 | 1878531 | 1878860 | + | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
24 | 32207 | 32500 | + | NZ_CP046531.1 | Mannheimia ovis |
25 | 32217 | 32510 | + | NZ_CP055305.1 | Mannheimia pernigra |
26 | 47851 | 48141 | - | NZ_CP061280.1 | Mannheimia bovis |
27 | 334885 | 335217 | + | NZ_CP016604.1 | Otariodibacter oris |
28 | 2202045 | 2202335 | - | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |
29 | 1748691 | 1748984 | - | NZ_CP006944.1 | Mannheimia varigena USDA-ARS-USMARC-1312 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01812.22 | 0.93 | 27 | 290 | same-strand | 5-formyltetrahydrofolate cyclo-ligase family |
2 | PF03695.15 | 0.83 | 24 | 81.0 | opposite-strand | Uncharacterised protein family (UPF0149) |