ProsmORF-pred
Result : A0LIJ8
Protein Information
Information Type Description
Protein name 50S ribosomal protein L29
NCBI Accession ID CP000478.1
Organism Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Left 1921963
Right 1922163
Strand +
Nucleotide Sequence ATGAAAACCAATGCGCTGCGAGACATGACGAATGACGAGCTGCTCCAGAAGCTCGCGGAAATCCGACAGGCGCTGTTCAATCTCAACTTTCAGCATGTGACGGGACAGTTGGAGAACACCGCTCAAATCAACAAGAATCGGAAAGACATCGCCCGAATCTTGACGATTCTTCACGAGCGCGAGCAGAAGACGGCGGCATAA
Sequence MKTNALRDMTNDELLQKLAEIRQALFNLNFQHVTGQLENTAQINKNRKDIARILTILHEREQKTAA
Source of smORF Swiss-Prot
Function The ORF matches to the profile of cl09943. Profile Description: N/A. This family represents the N-terminal region (approximately 8 residues) of the eukaryotic mitochondrial 39-S ribosomal protein L47 (MRP-L47). Mitochondrial ribosomal proteins (MRPs) are the counterparts of the cytoplasmic ribosomal proteins, in that they fulfil similar functions in protein biosynthesis. However, they are distinct in number, features and primary structure.
Pubmed ID
Domain CDD:415815
Functional Category Ribosomal_protein
Uniprot ID A0LIJ8
ORF Length (Amino Acid) 66
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 456
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 1921963 1922163 + NC_008554.1 Syntrophobacter fumaroxidans MPOB
2 365042 365233 - NZ_CP040098.1 Desulfoglaeba alkanexedens ALDC
3 3755126 3755329 - NC_014624.2 Eubacterium callanderi
4 1380850 1381053 + NZ_CP019962.1 Eubacterium limosum
5 4573303 4573506 - NC_009633.1 Alkaliphilus metalliredigens QYMF
6 175199 175399 + NZ_CP038015.1 Paenisporosarcina antarctica
7 4179444 4179647 - NZ_CP020559.1 Clostridium formicaceticum
8 143858 144058 + NZ_CP016538.2 Planococcus maritimus
9 143699 143899 + NZ_CP059540.1 Planococcus maritimus
10 3332017 3332217 + NZ_CP013659.2 Planococcus rifietoensis
11 1939593 1939802 - NC_014209.1 Thermoanaerobacter mathranii subsp. mathranii str. A3
12 2006920 2007129 - NC_013921.1 Thermoanaerobacter italicus Ab9
13 563994 564197 + NC_009922.1 Alkaliphilus oremlandii OhILAs
14 184540 184740 + NC_014378.1 Acetohalobium arabaticum DSM 5501
15 354918 355115 + NZ_AP019750.1 Lactobacillus delbrueckii subsp. delbrueckii
16 1652487 1652675 - NZ_CP015519.1 Syntrophotalea acetylenivorans
17 2487738 2487926 - NC_011768.1 Desulfatibacillum aliphaticivorans
18 3096340 3096540 - NZ_CP014342.1 Geobacillus subterraneus
19 1959835 1960032 - NZ_CP009170.1 Thermoanaerobacter kivui
20 146226 146426 + NZ_CP016537.2 Planococcus halocryophilus
21 2290089 2290298 - NC_015958.1 Thermoanaerobacter wiegelii Rt8.B1
22 143230 143430 + NZ_CP016539.2 Planococcus plakortidis
23 244239 244451 + NZ_CP048103.1 Kroppenstedtia eburnea
24 418891 419100 + NC_014964.1 Thermoanaerobacter brockii subsp. finnii Ako-1
25 134198 134398 + NZ_CP016540.2 Planococcus versutus
26 166360 166560 + NZ_CP016543.2 Planococcus donghaensis
27 1616306 1616506 - NZ_CP013661.2 Planococcus kocurii
28 146371 146571 + NZ_CP019401.1 Planococcus faecalis
29 150886 151086 + NZ_CP016534.2 Planococcus antarcticus DSM 14505
30 4469570 4469794 + NZ_CP029043.1 Streptomyces nigra
31 138039 138239 + NC_006270.3 Bacillus licheniformis DSM 13 = ATCC 14580
32 170519 170719 + NZ_CP023665.1 Bacillus paralicheniformis
33 146504 146704 + NZ_LT603683.1 Bacillus glycinifermentans
34 2374725 2374928 - NZ_AP021874.1 Desulfosarcina alkanivorans
35 4043688 4043891 - NZ_CP016020.1 Bacillus weihaiensis
36 224366 224563 + NC_010718.1 Natranaerobius thermophilus JW/NM-WN-LF
37 6982749 6982952 + NZ_AP021876.1 Desulfosarcina ovata subsp. sediminis
38 141770 141970 + NZ_CP042593.1 Bacillus dafuensis
39 1752290 1752490 - NZ_CP041305.1 Cytobacillus ciccensis
40 3268666 3268866 + NZ_CP064060.1 Anoxybacillus caldiproteolyticus
41 3211443 3211667 - NZ_CP023701.1 Streptomyces subrutilus
42 3125140 3125364 - NZ_CP023692.1 Streptomyces vinaceus
43 5427397 5427621 + NZ_CP071139.1 Streptomyces nojiriensis
44 619573 619797 + NZ_CP030862.1 Streptomyces globosus
45 357549 357752 + NC_015555.1 Thermoanaerobacterium xylanolyticum LX-11
46 2253303 2253506 - NZ_CP047602.1 Thermoanaerobacterium aotearoense
47 433736 433939 + NC_014410.1 Thermoanaerobacterium thermosaccharolyticum DSM 571
48 150875 151075 + NZ_CP009416.1 Jeotgalibacillus malaysiensis
49 2162413 2162616 - NZ_CP029487.1 Eubacterium maltosivorans
50 3790457 3790657 - NZ_CP011937.1 Bacillus velezensis
51 275912 276112 + NZ_CP033052.1 Bacillus vallismortis
52 139865 140065 + NZ_CP048852.1 Bacillus tequilensis
53 140884 141084 + NZ_CP053376.1 Bacillus amyloliquefaciens
54 139625 139825 + NZ_CP051464.1 Bacillus mojavensis
55 139751 139951 + NZ_CP034943.1 Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499
56 109645 109845 + NZ_CP013984.1 Bacillus inaquosorum
57 1869577 1869777 - NZ_CP029364.1 Bacillus halotolerans
58 139924 140124 + NC_000964.3 Bacillus subtilis subsp. subtilis str. 168
59 135171 135374 + NZ_CP065425.1 Heyndrickxia vini
60 1942057 1942257 - NZ_CP022983.1 Cytobacillus kochii
61 145633 145836 + NC_022524.1 Bacillus infantis NRRL B-14911
62 254493 254696 + NZ_CP053989.1 Niallia circulans
63 295175 295372 + NC_021181.2 Lactobacillus acidophilus La-14
64 358394 358591 + NZ_CP061341.1 Lactobacillus kefiranofaciens
65 398170 398367 + NZ_CP059829.1 Lactobacillus ultunensis
66 2164293 2164457 - NC_008148.1 Rubrobacter xylanophilus DSM 9941
67 314167 314361 + NZ_CP039543.1 Desulfovibrio marinus
68 1638674 1638874 + NZ_CP034248.1 Paenibacillus lentus
69 3819015 3819218 - NZ_CP009687.1 Clostridium aceticum
70 345945 346151 - NZ_CP070511.1 Parageobacillus toebii
71 132214 132414 + NC_006510.1 Geobacillus kaustophilus HTA426
72 2825866 2826066 + NZ_CP061470.1 Geobacillus zalihae
73 140921 141121 - NZ_CP018058.1 Geobacillus thermocatenulatus
74 2263947 2264147 - NZ_CP061472.1 Geobacillus thermoleovorans
75 479266 479472 - NZ_CP016622.1 Parageobacillus thermoglucosidasius
76 1534906 1535139 - NZ_CP042429.1 Corynebacterium nuruki S6-4
77 3684572 3684796 + NZ_CP032229.1 Streptomyces seoulensis
78 4609230 4609454 + NZ_CP023407.1 Streptomyces fungicidicus
79 4352011 4352235 + NZ_CP015866.1 Streptomyces parvulus
80 4753661 4753885 + NZ_CP063374.1 Streptomyces chromofuscus
81 4551838 4552062 + NZ_AP023439.1 Streptomyces tuirus
82 4338489 4338713 + NZ_CP022310.1 Streptomyces calvus
83 3660250 3660474 - NZ_CP051006.1 Streptomyces griseofuscus
84 5205309 5205533 + NZ_CP071839.1 Streptomyces cyanogenus
85 3964675 3964899 - NZ_CP030073.1 Streptomyces cadmiisoli
86 4211516 4211740 - NZ_CP017248.1 Streptomyces fodineus
87 4098366 4098590 - NZ_CP023689.1 Streptomyces chartreusis
88 9178234 9178458 - NZ_CP063373.1 Streptomyces ferrugineus
89 6066057 6066281 + NZ_CP034539.1 Streptomyces cyaneochromogenes
90 895304 895528 + NZ_CP016279.1 Streptomyces griseochromogenes
91 5087121 5087345 + NC_021985.1 Streptomyces collinus Tu 365
92 5629352 5629576 + NZ_CP047020.1 Streptomyces broussonetiae
93 4559146 4559370 + NZ_CP023693.1 Streptomyces cinereoruber
94 3049504 3049728 - NZ_CP023702.1 Streptomyces nitrosporeus
95 4609451 4609675 + NZ_CP029196.1 Streptomyces venezuelae
96 5073219 5073443 + NZ_CP010407.1 Streptomyces vietnamensis
97 5310093 5310317 + NZ_CP059991.1 Streptomyces gardneri
98 2767656 2767880 - NZ_CP021080.1 Streptomyces pluripotens
99 2117966 2118166 + NZ_CP015108.1 Sporosarcina ureae
100 145929 146129 + NC_004193.1 Oceanobacillus iheyensis HTE831
101 1488434 1488634 - NZ_CP017786.1 Bacillus xiamenensis
102 113204 113404 + NZ_CP011150.1 Bacillus altitudinis
103 1405500 1405700 - NZ_CP043404.1 Bacillus safensis
104 334989 335189 + NZ_CP014616.1 Sporosarcina psychrophila
105 1470367 1470558 - NC_016630.1 Filifactor alocis ATCC 35896
106 3909011 3909235 + NZ_CP017316.1 Streptomyces rubrolavendulae
107 4070903 4071127 + NZ_CP023696.1 Streptomyces fradiae ATCC 10745 = DSM 40063
108 2344065 2344268 + NZ_CP009709.1 Weizmannia coagulans DSM 1 = ATCC 7050
109 1324136 1324330 + NC_012881.1 Maridesulfovibrio salexigens DSM 2638
110 132279 132452 + NZ_CP019699.1 Novibacillus thermophilus
111 4581909 4582109 + NZ_CP013652.1 Paenibacillus naphthalenovorans
112 4989390 4989614 + NZ_CP020563.1 Kitasatospora albolonga
113 2370437 2370640 - NC_018664.1 Gottschalkia acidurici 9a
114 4740022 4740222 + NZ_CP018866.1 Sutcliffiella cohnii
115 2090835 2091065 - NZ_LT906473.1 Corynebacterium cystitidis
116 4622327 4622551 + NZ_CP010849.1 Streptomyces cyaneogriseus subsp. noncyanogenus
117 3546173 3546397 - NZ_LN831790.1 Streptomyces leeuwenhoekii
118 5254372 5254596 + NZ_CP021978.1 Streptomyces hawaiiensis
119 5448873 5449097 + NZ_CP015098.1 Streptomyces qaidamensis
120 5617656 5617880 + NZ_CP023694.1 Streptomyces coeruleorubidus
121 3941231 3941455 - NZ_CP032427.1 Streptomyces griseorubiginosus
122 5730048 5730272 + NZ_CP023690.1 Streptomyces spectabilis
123 6600740 6600964 + NZ_CP045096.1 Streptomyces phaeolivaceus
124 6308164 6308388 + NZ_CP034463.1 Streptomyces aquilus
125 1898935 1899156 + NC_014414.1 Parvularcula bermudensis HTCC2503
126 1197906 1198106 + NZ_CP017703.1 Aeribacillus pallidus
127 2171368 2171568 - NC_003869.1 Caldanaerobacter subterraneus subsp. tengcongensis MB4
128 1291034 1291225 + NZ_CP023643.1 Brochothrix thermosphacta
129 85979 86182 + NZ_CP014150.1 Paeniclostridium sordellii
130 3723629 3723832 + NZ_CP017269.1 Geosporobacter ferrireducens
131 2577651 2577854 + NZ_CP030926.1 Peribacillus butanolivorans
132 2436116 2436319 - NZ_CP017704.1 Peribacillus simplex NBRC 15720 = DSM 1321
133 415662 415856 + NZ_CP011391.1 Faecalibaculum rodentium
134 56635 56835 - NZ_CP015438.1 Anoxybacillus amylolyticus
135 1145864 1146070 + NC_012440.1 Persephonella marina EX-H1
136 1637731 1637943 - NC_015437.1 Selenomonas sputigena ATCC 35185
137 3315253 3315456 - NC_016894.1 Acetobacterium woodii DSM 1030
138 1240138 1240338 + NC_011653.1 Thermosipho africanus TCF52B
139 48200 48412 - NZ_CP039710.1 Thermoactinomyces vulgaris
140 2965839 2966063 - NZ_CP034279.1 Streptomyces ficellus
141 142923 143126 + NZ_CP012024.1 Bacillus smithii
142 2939387 2939584 + NZ_CP045798.1 Thermoanaerosceptrum fracticalcis
143 160875 161072 - NZ_AP017312.1 Aneurinibacillus soli
144 2574412 2574612 - NZ_CP011361.2 Salimicrobium jeotgali
145 1546433 1546630 - NZ_CP015444.1 Lactobacillus helveticus
146 4284792 4285019 + NZ_CP029254.1 Streptomyces spongiicola
147 132617 132817 + NZ_CP024035.1 Priestia aryabhattai
148 4057130 4057354 + NZ_CP029188.1 Streptomyces tirandamycinicus
149 3725978 3726202 - NZ_CP011340.1 Streptomyces pristinaespiralis
150 125734 125931 + NZ_CP031513.1 Bombilactobacillus bombi
151 4683329 4683553 + NZ_CP023695.1 Streptomyces alboniger
152 52654 52854 - NZ_CP020772.1 Halobacillus mangrovi
153 148351 148551 + NC_017668.1 Halobacillus halophilus DSM 2266
154 3074540 3074752 - NZ_CP048104.1 Kroppenstedtia pulmonis
155 2101434 2101631 - NZ_HF545616.1 Ruminococcus bicirculans
156 184965 185165 + NZ_CP029797.1 Paraliobacillus zengyii
157 3950415 3950618 - NZ_CP019870.1 Clostridioides difficile
158 190498 190707 - NZ_CP046314.1 Gemella morbillorum
159 1758715 1758924 - NZ_LR134484.1 Gemella haemolysans
160 2694784 2694987 - NZ_CP068053.1 Peribacillus psychrosaccharolyticus
161 824720 824944 + NZ_CP051486.1 Streptomyces pratensis
162 5380908 5381132 + NZ_CP027306.1 Streptomyces atratus
163 2637185 2637409 - NZ_CP065253.1 Streptomyces clavuligerus
164 4884646 4884816 + NZ_CP020700.1 Streptomyces tsukubensis
165 4749110 4749280 + NZ_CP042266.1 Streptomyces qinzhouensis
166 1370395 1370595 - NZ_CP018622.1 Virgibacillus dokdonensis
167 4653447 4653671 + NZ_CP024957.1 Streptomyces cavourensis
168 4852371 4852595 + NZ_CP013738.1 Streptomyces globisporus C-1027
169 4877596 4877820 + NZ_CP070242.1 Streptomyces californicus
170 4960904 4961128 + NC_021177.1 Streptomyces fulvissimus DSM 40593
171 4937399 4937623 + NZ_CP020570.1 Streptomyces violaceoruber
172 3593025 3593249 - NZ_CP032698.1 Streptomyces hundungensis
173 3329745 3329969 - NC_010572.1 Streptomyces griseus subsp. griseus NBRC 13350
174 155853 156053 + NZ_CP041666.1 Radiobacillus deserti
175 6313346 6313546 - NZ_CP048209.1 Paenibacillus lycopersici
176 4779887 4780111 + NZ_CP023703.1 Streptomyces galilaeus
177 4766971 4767195 + NZ_CP012382.1 Streptomyces ambofaciens ATCC 23877
178 3564020 3564244 - NZ_CP026652.1 Streptomyces dengpaensis
179 4021737 4021961 - NZ_CP045643.1 Streptomyces fagopyri
180 3648725 3648949 - NZ_CP034687.1 Streptomyces griseoviridis
181 5992008 5992232 + NC_003155.5 Streptomyces avermitilis MA-4680 = NBRC 14893
182 5677298 5677522 + NZ_AP023440.1 Streptomyces glomeroaurantiacus
183 151793 151993 + NZ_CP017962.1 Virgibacillus halodenitrificans
184 473845 474048 + NC_011830.1 Desulfitobacterium hafniense DCB-2
185 1937442 1937648 - NZ_CP068564.1 Keratinibaculum paraultunense
186 342289 342486 + NZ_CP059276.1 Lactobacillus taiwanensis
187 337584 337781 + NC_008530.1 Lactobacillus gasseri ATCC 33323 = JCM 1131
188 340531 340728 + NZ_AP018549.1 Lactobacillus paragasseri
189 221273 221476 - NZ_CP014230.1 Desulfomicrobium orale DSM 12838
190 132200 132397 + NC_014377.1 Thermosediminibacter oceani DSM 16646
191 274306 274503 + NZ_CP031835.1 Lactobacillus amylolyticus
192 4130937 4131137 - NZ_CP031223.1 Psychrobacillus glaciei
193 2247123 2247320 + NZ_AP018449.1 Methylomusa anaerophila
194 2811115 2811339 - NZ_CP048882.1 Streptomyces bathyalis
195 140903 141106 + NC_011899.1 Halothermothrix orenii H 168
196 6049872 6050096 + NZ_CP022744.1 Streptomyces lincolnensis
197 5601971 5602195 + NZ_CP022685.1 Streptomyces formicae
198 4167646 4167870 - NZ_CP023699.1 Streptomyces kanamyceticus
199 4154969 4155193 - NC_013929.1 Streptomyces scabiei 87.22
200 225578 225778 - NZ_CP034437.1 Paenibacillus albus
201 4222306 4222506 + NZ_CP048286.1 Paenibacillus rhizovicinus
202 442204 442407 + NC_018017.1 Desulfitobacterium dehalogenans ATCC 51507
203 337160 337345 + NZ_CP030777.1 Faecalibacterium prausnitzii
204 2302305 2302496 - NZ_LT906453.1 Dermatophilus congolensis
205 1665247 1665447 - NZ_AP014510.1 Thermotoga profunda AZM34c06
206 2748460 2748684 - NZ_CP031194.1 Streptomyces paludis
207 3877595 3877819 + NC_016111.1 Streptomyces cattleya NRRL 8057 = DSM 46488
208 2713810 2714034 - NZ_CP031264.1 Streptacidiphilus bronchialis
209 243012 243215 + NC_018515.1 Desulfosporosinus meridiei DSM 13257
210 394355 394552 + NZ_CP044496.1 Lactobacillus acetotolerans
211 2073726 2073962 - NZ_CP054938.1 Streptomyces harbinensis
212 1377659 1377856 - NZ_CP029544.1 Lactobacillus helsingborgensis
213 1466931 1467128 - NZ_CP029477.1 Lactobacillus kullabergensis
214 776751 776957 + NZ_CP054599.1 Sulfitobacter pseudonitzschiae
215 134606 134806 + NZ_CP024848.1 Oceanobacillus zhaokaii
216 143151 143351 + NC_018704.1 Amphibacillus xylanus NBRC 15112
217 466075 466278 + NC_019903.1 Desulfitobacterium dichloroeliminans LMG P-21439
218 426031 426225 - NZ_CP018888.1 Amylolactobacillus amylophilus DSM 20533 = JCM 1125
219 2069078 2069287 - NC_007503.1 Carboxydothermus hydrogenoformans Z-2901
220 8373599 8373799 - NC_017672.3 Paenibacillus mucilaginosus K02
221 1406339 1406542 + NZ_CP059066.1 Koleobacter methoxysyntrophicus
222 3453531 3453731 + NZ_CP008876.1 Terribacillus goriensis
223 2278251 2278439 - NC_007519.1 Desulfovibrio alaskensis G20
224 4268219 4268443 + NC_020990.1 Streptomyces albidoflavus
225 4570035 4570259 + NZ_CP031742.1 Streptomyces koyangensis
226 6055463 6055663 + NZ_AP019308.1 Paenibacillus baekrokdamisoli
227 124152 124352 + NZ_CP012152.1 Anoxybacillus gonensis
228 993066 993266 + NZ_CP007389.1 Thermosipho melanesiensis
229 241739 241942 + NC_016584.1 Desulfosporosinus orientis DSM 765
230 444577 444771 + NZ_AP017378.1 Desulfovibrio ferrophilus
231 3870650 3870874 - NZ_CP019457.1 Streptomyces lydicus
232 32566 32769 - NZ_CP036523.1 Peptacetobacter hiranonis
233 151270 151470 + NZ_CP023704.1 Caldibacillus thermoamylovorans
234 4610650 4610874 - NZ_CP070326.1 Streptomyces noursei
235 6471148 6471372 + NZ_CP065050.1 Streptomyces solisilvae
236 7505777 7506001 + NC_016582.1 Streptomyces bingchenggensis BCW-1
237 504617 504820 + NC_018068.1 Desulfosporosinus acidiphilus SJ4
238 204585 204776 + NZ_CP060720.1 Vagococcus carniphilus
239 406392 406589 + NZ_CP018809.1 Lactobacillus jensenii
240 1277853 1278050 - NZ_CP029476.1 Lactobacillus apis
241 4496811 4497011 - NZ_CP006837.1 Lysinibacillus varians
242 247718 247918 + NZ_CP019980.1 Lysinibacillus sphaericus
243 203905 204105 + NZ_CP010820.1 Lysinibacillus fusiformis
244 285367 285564 - NZ_CP026363.1 Brevibacillus agri
245 3437967 3438173 - NC_015730.1 Roseobacter litoralis Och 149
246 2121222 2121413 - NZ_CP017267.1 Vagococcus teuberi
247 2251698 2251931 - NC_021663.1 Corynebacterium terpenotabidum Y-11
248 290274 290480 + NC_009952.1 Dinoroseobacter shibae DFL 12 = DSM 16493
249 2935467 2935691 - NZ_CP023202.1 Streptomyces xinghaiensis S187
250 2245727 2245963 - NZ_CP009922.3 Streptomyces xiamenensis
251 2216890 2217096 - NC_012982.1 Hirschia baltica ATCC 49814
252 3300079 3300303 - NZ_CP072827.1 Streptomyces mobaraensis NBRC 13819 = DSM 40847
253 4209062 4209286 - NZ_CP020569.1 Streptomyces gilvosporeus
254 5204744 5204968 + NZ_CP023688.1 Streptomyces rimosus
255 3540005 3540205 + NZ_CP016379.1 Anoxybacter fermentans
256 3444730 3444936 + NZ_CP049037.1 Pseudohalocynthiibacter aestuariivivens
257 4176693 4176899 + NZ_CP045201.1 Pseudopuniceibacterium antarcticum
258 51665 51868 + NZ_CP040676.1 Exiguobacterium mexicanum
259 1018855 1019058 + NC_011661.1 Dictyoglomus turgidum DSM 6724
260 3124836 3125024 - NC_002939.5 Geobacter sulfurreducens PCA
261 2099865 2100062 + NZ_CP014912.1 Secundilactobacillus paracollinoides
262 2539138 2539338 - NZ_CP013862.1 Lentibacillus amyloliquefaciens
263 1520167 1520361 - NZ_LT906446.1 Megamonas hypermegale
264 1401188 1401373 + NC_017310.1 Desulfovibrio vulgaris RCH1
265 173353 173556 + NC_002570.2 Alkalihalobacillus halodurans C-125
266 2304374 2304571 - NC_014614.1 Acetoanaerobium sticklandii
267 1307762 1307962 + NZ_CP004388.1 Thalassospira xiamenensis M-5 = DSM 17429
268 1710956 1711162 + NZ_CP036532.1 Roseitalea porphyridii
269 271049 271258 + NZ_CP011366.1 Salinicoccus halodurans
270 4842169 4842369 - NZ_CP045293.1 Paenibacillus guangzhouensis
271 184145 184357 + NZ_CP034118.1 Staphylospora marina
272 4056954 4057133 - NZ_CP019066.1 Tsukamurella tyrosinosolvens
273 678864 679079 + NZ_CP036250.1 Egicoccus halophilus
274 344339 344569 + NZ_CP011546.1 Corynebacterium uterequi
275 2059350 2059538 - NZ_CP021874.1 Enterococcus wangshanyuanii
276 1137133 1137324 + NZ_CP049887.1 Vagococcus hydrophili
277 3516973 3517152 - NC_014158.1 Tsukamurella paurometabola DSM 20162
278 2326349 2326546 + NZ_CP017705.1 Brevibacillus laterosporus DSM 25
279 50803 51000 + NC_014833.1 Ruminococcus albus 7 = DSM 20455
280 396321 396509 - NZ_CP049886.1 Vagococcus coleopterorum
281 218219 218434 + NC_015519.1 Tepidanaerobacter acetatoxydans Re1
282 3562663 3562863 - NZ_CP041636.1 Ferrovibrio terrae
283 73445 73636 + NZ_CP039712.1 Vagococcus zengguangii
284 647916 648113 - NZ_CP048877.1 Thermosulfuriphilus ammonigenes
285 3244763 3244969 - NZ_CP065915.1 Pelagovum pacificum
286 666420 666617 + NZ_CP004393.1 Celeribacter indicus
287 3497542 3497766 - NZ_CP060404.1 Streptomyces buecherae
288 3479391 3479615 - NZ_CP072931.1 Streptomyces auratus AGR0001
289 125979 126182 + NZ_CP015378.1 Fictibacillus phosphorivorans
290 4687785 4687985 - NZ_CP004078.1 Paenibacillus sabinae T27
291 5017407 5017604 - NZ_CP009286.1 Paenibacillus stellifer
292 5294858 5295055 - NZ_CP009288.1 Paenibacillus durus
293 5132786 5132986 - NZ_CP013023.1 Paenibacillus bovis
294 3986684 3986881 + NZ_CP016809.1 Paenibacillus ihbetae
295 472383 472619 + NZ_CP006841.1 Corynebacterium lactis RW2-5
296 3676449 3676655 - NC_011831.1 Chloroflexus aggregans DSM 9485
297 1822984 1823190 - NZ_CP035130.1 Gudongella oleilytica
298 3620039 3620239 - NZ_CP014167.1 Paenibacillus yonginensis
299 239759 239947 + NZ_LS483306.1 Enterococcus cecorum
300 66514 66702 + NC_020207.1 Enterococcus faecium ATCC 8459 = NRRL B-2354
301 71014 71202 + NZ_CP023074.1 Enterococcus thailandicus
302 73621 73809 + NZ_CP065211.1 Enterococcus lactis
303 2430066 2430254 - NZ_AP022822.1 Enterococcus saigonensis
304 586054 586242 - NZ_CP023011.2 Enterococcus hirae
305 3161873 3162061 + NZ_CP018061.1 Enterococcus mundtii
306 410408 410581 + NC_015172.1 Syntrophobotulus glycolicus DSM 8271
307 257222 257410 + NC_020995.1 Enterococcus casseliflavus EC20
308 1658935 1659171 - NZ_CP032788.1 Corynebacterium xerosis
309 2660335 2660535 - NC_008346.1 Syntrophomonas wolfei subsp. wolfei str. Goettingen G311
310 4390963 4391160 + NZ_CP045295.1 Paenibacillus cellulositrophicus
311 6154748 6154945 - NZ_CP009428.1 Paenibacillus odorifer
312 1126374 1126571 - NZ_CP048429.1 Paenibacillus jilunlii
313 6433045 6433242 - NZ_CP009287.1 Paenibacillus graminis
314 1148700 1148897 - NZ_CP068595.1 Paenibacillus sonchi
315 7133967 7134164 - NZ_LN831776.1 Paenibacillus riograndensis SBR5
316 7397918 7398115 - NZ_CP009285.1 Paenibacillus borealis
317 6279740 6279937 - NZ_CP021780.1 Paenibacillus donghaensis
318 3631379 3631576 - NZ_CP033433.1 Cohnella candidum
319 508837 509034 - NC_017079.1 Caldilinea aerophila DSM 14535 = NBRC 104270
320 1751581 1751778 + NZ_CP043611.1 Paenibacillus antarcticus
321 1100933 1101127 + NZ_AP019004.1 Phascolarctobacterium faecium
322 1631193 1631396 + NZ_CP063356.1 Anaerobacillus isosaccharinicus
323 2697272 2697460 - NZ_CP010311.1 Geoalkalibacter subterraneus
324 2422543 2422740 - NZ_AP022593.1 Mycolicibacterium arabiense
325 3511745 3511951 + NZ_CP027407.1 Roseobacter denitrificans
326 1086514 1086738 + NC_013131.1 Catenulispora acidiphila DSM 44928
327 2129947 2130141 - NC_013740.1 Acidaminococcus fermentans DSM 20731
328 162369 162572 + NZ_CP042261.1 Qingshengfaniella alkalisoli
329 980087 980296 + NZ_CP040517.1 Luteithermobacter gelatinilyticus
330 387327 387509 + NZ_CP028106.1 Fusobacterium gonidiaformans ATCC 25563
331 236731 236913 - NZ_CP028107.1 Fusobacterium necrophorum subsp. funduliforme
332 517629 517811 + NZ_CP068114.1 Fusobacterium canifelinum
333 1677194 1677376 + NZ_CP024699.1 Fusobacterium pseudoperiodonticum
334 569262 569444 + NZ_CP013336.1 Fusobacterium hwasookii ChDC F206
335 429945 430127 + NZ_LN831027.1 Fusobacterium nucleatum subsp. polymorphum
336 5699229 5699426 - NZ_CP034346.1 Paenibacillus lutimineralis
337 270815 271021 + NZ_LR026975.1 Mycolicibacterium hassiacum DSM 44199
338 2868068 2868268 - NZ_CP049250.1 Rhizobium rhizoryzae
339 129337 129540 + NC_010556.1 Exiguobacterium sibiricum 255-15
340 3980759 3980995 - NZ_CP027793.1 Rhodococcus hoagii
341 1121755 1121964 + NC_014960.1 Anaerolinea thermophila UNI-1
342 72410 72610 + NZ_CP048632.1 Rhizobium oryzihabitans
343 3539215 3539442 - NZ_AP022563.1 Mycolicibacterium duvalii
344 249478 249681 + NZ_CP034235.1 Paenibacillus psychroresistens
345 2596511 2596702 - NC_013891.1 Listeria seeligeri serovar 1/2b str. SLCC3954
346 2606828 2607019 - NZ_LT906444.1 Listeria welshimeri
347 2722395 2722586 - NZ_CP009577.1 Listeria ivanovii subsp. ivanovii
348 2701254 2701445 - NC_003210.1 Listeria monocytogenes EGD-e
349 141190 141393 + NC_013791.2 Alkalihalobacillus pseudofirmus OF4
350 204252 204452 + NC_023135.1 Leisingera methylohalidivorans DSM 14336
351 1004039 1004221 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
352 1627079 1627279 - NZ_CP061003.1 Agrobacterium tumefaciens
353 2152563 2152751 - NZ_CP012047.1 Tetragenococcus halophilus
354 540247 540477 + NZ_CP006764.1 Corynebacterium doosanense CAU 212 = DSM 45436
355 2108439 2108642 - NC_014654.1 Halanaerobium hydrogeniformans
356 341536 341766 + NZ_CP011312.1 Corynebacterium kutscheri
357 2634665 2634898 + NZ_LR214441.1 Tessaracoccus lapidicaptus
358 1159569 1159769 + NZ_AP018712.1 Tepiditoga spiralis
359 1399519 1399707 + NC_010814.1 Geobacter lovleyi SZ
360 1666971 1667204 + NZ_AP022570.1 Mycolicibacterium poriferae
361 2452561 2452752 + NC_016629.1 Desulfocurvibacter africanus subsp. africanus str. Walvis Bay
362 630983 631219 + NC_014165.1 Thermobispora bispora DSM 43833
363 530534 530740 + NZ_LN898144.1 Paucilactobacillus oligofermentans DSM 15707 = LMG 22743
364 2076155 2076358 - NZ_CP035485.1 Salicibibacter halophilus
365 5475694 5475876 - NZ_AP022560.1 Mycolicibacterium moriokaense
366 5887433 5887660 - NZ_CP020809.1 Mycobacterium dioxanotrophicus
367 1273420 1273617 - NZ_LT821227.1 Phoenicibacter congonensis
368 1586406 1586606 + NZ_CP006877.1 Rhizobium gallicum bv. gallicum R602sp
369 851472 851675 + NC_011297.1 Dictyoglomus thermophilum H-6-12
370 2038495 2038725 - NZ_CP033898.1 Corynebacterium pseudopelargi
371 2055195 2055425 - NZ_CP035299.1 Corynebacterium pelargi
372 218227 218427 + NZ_CP015230.1 Epibacterium mobile F1926
373 1260685 1260879 - NC_016605.1 Pediococcus claussenii ATCC BAA-344
374 3557073 3557297 - NC_016109.1 Kitasatospora setae KM-6054
375 1398805 1399011 - NZ_CP044534.1 Limosilactobacillus frumenti
376 1564044 1564250 - NZ_CP045605.1 Limosilactobacillus reuteri
377 4480489 4480713 + NZ_CP023698.1 Streptomyces viridifaciens
378 367610 367807 + NZ_CP026948.1 Corynebacterium liangguodongii
379 1544079 1544282 + NC_015681.1 Thermodesulfatator indicus DSM 15286
380 1449468 1449656 - NC_022538.1 Acholeplasma palmae J233
381 3261328 3261528 - NZ_CP049241.1 Rhizobium pseudoryzae
382 6128453 6128650 - NZ_AP019400.1 Cohnella abietis
383 1775646 1775837 - NZ_CP013988.1 Aerococcus urinaeequi
384 427616 427807 + NZ_CP014164.1 Aerococcus viridans
385 428199 428429 + NZ_CP039247.1 Corynebacterium endometrii
386 628851 629081 - NZ_CP009312.1 Lawsonella clevelandensis
387 2000723 2000887 - NZ_CP022110.1 Nitrospirillum amazonense CBAmc
388 4489281 4489463 + NZ_AP022569.1 Mycobacterium cookii
389 1271017 1271217 + NZ_HG938353.1 Neorhizobium galegae bv. orientalis str. HAMBI 540
390 1374865 1375059 - NZ_CP042304.1 Devosia ginsengisoli
391 561005 561178 + NZ_CP046996.1 Dehalobacter restrictus
392 3138638 3138838 - NZ_CP010650.1 Phaeobacter inhibens
393 1804501 1804698 + NZ_CP021330.1 Maritalea myrionectae
394 303616 303816 + NZ_CP021047.1 Phaeobacter gallaeciensis
395 704480 704668 + NC_007517.1 Geobacter metallireducens GS-15
396 814928 815125 - NZ_CP014163.1 Aerococcus urinaehominis
397 1008610 1008828 + NZ_CP034791.1 Caldicellulosiruptor changbaiensis
398 2400852 2401070 - NC_009437.1 Caldicellulosiruptor saccharolyticus DSM 8903
399 785602 785793 + NC_013525.1 Thermobaculum terrenum ATCC BAA-798
400 1092498 1092701 - NC_017096.1 Caldisericum exile AZM16c01
401 489245 489412 - NZ_CP038157.1 Corynebacterium sanguinis
402 1317456 1317662 - NZ_CP045530.1 Limosilactobacillus pontis
403 871665 871871 - NC_016751.1 Marinitoga piezophila KA3
404 2471743 2471970 + NZ_AP022588.1 Mycolicibacterium sediminis
405 4115546 4115782 - NZ_CP022208.1 Rhodococcus pyridinivorans
406 3777450 3777686 - NZ_LT906450.1 Rhodococcus rhodochrous
407 1510281 1510487 - NZ_CP045240.1 Limosilactobacillus vaginalis
408 1273009 1273191 - NZ_AP022596.1 Mycolicibacterium helvum
409 2126558 2126794 + NZ_CP068168.1 Corynebacterium amycolatum
410 4287145 4287345 - NZ_CP010803.1 Martelella endophytica
411 726824 727012 + NC_008609.1 Pelobacter propionicus DSM 2379
412 3077520 3077717 + NZ_CP022196.1 Celeribacter ethanolicus
413 1481869 1482051 + NZ_CP011269.1 Mycolicibacterium fortuitum
414 603924 604157 + NZ_LS483459.1 Corynebacterium jeikeium
415 1887739 1887972 - NZ_CP046883.1 Corynebacterium anserum
416 686181 686375 + NZ_AP012547.1 Sulfuritalea hydrogenivorans sk43H
417 1522307 1522468 - NZ_CP014161.1 Aerococcus urinae
418 1959035 1959265 - NZ_CP033897.1 Corynebacterium gerontici
419 1200657 1200842 + NC_020127.1 Lawsonia intracellularis N343
420 2458271 2458465 - NZ_CP014646.1 Thauera humireducens
421 474145 474360 + NC_018024.1 Acetomicrobium mobile DSM 13181
422 2586073 2586267 + NZ_CP034438.1 Flaviflexus salsibiostraticola
423 213929 214129 + NC_002678.2 Mesorhizobium japonicum MAFF 303099
424 457788 457982 + NC_004757.1 Nitrosomonas europaea ATCC 19718
425 2469723 2469893 + NZ_CP077717.1 Saccharolobus shibatae B12
426 4143040 4143240 - NZ_CP033361.1 Mesorhizobium erdmanii
427 4781534 4781734 - NZ_CP033507.1 Mesorhizobium jarvisii
428 2864598 2864822 - NZ_CP011502.1 Aeromicrobium erythreum
429 6050121 6050321 + NZ_CP050296.1 Mesorhizobium huakuii
430 747882 748070 + NZ_CP009788.1 Geobacter pickeringii
431 969547 969783 + NZ_CP039291.1 Cellulomonas shaoxiangyii
432 4210833 4211033 - NZ_CP015318.1 Mesorhizobium amorphae CCNWGS0123
433 1102231 1102419 + NC_011146.1 Citrifermentans bemidjiense Bem
434 719277 719516 + NC_015588.1 Isoptericola variabilis 225
435 4305691 4305891 - NC_019973.1 Mesorhizobium australicum WSM2073
436 964274 964468 + NZ_CP014159.1 Aerococcus christensenii
437 2490619 2490813 + NZ_LN849456.1 Devriesea agamarum
438 911519 911758 + NC_015671.1 Cellulomonas gilvus ATCC 13127
439 1111043 1111282 + NC_015514.1 Cellulomonas fimi ATCC 484
440 4740215 4740415 - NC_015675.1 Mesorhizobium opportunistum WSM2075
441 2802127 2802303 - NZ_CP051884.1 Cellulomonas taurus
442 3683749 3683937 - NZ_AP023213.1 Citrifermentans bremense
443 3193230 3193430 - NZ_CP015064.1 Mesorhizobium ciceri biovar biserrulae
444 1696200 1696400 + NC_022795.1 Pseudothermotoga hypogea DSM 11164 = NBRC 106472
445 1780916 1781122 - NC_013939.1 Deferribacter desulfuricans SSM1
446 4720653 4720886 - NC_013757.1 Geodermatophilus obscurus DSM 43160
447 2580896 2581132 - NZ_CP041091.1 Nocardioides sambongensis
448 1896208 1896402 + NZ_CP018839.1 Thauera chlorobenzoica
449 2907834 2908028 - NZ_CP028339.1 Thauera aromatica K172
450 3673711 3673923 - NZ_CP028842.1 Clostridium botulinum
451 3954837 3955049 - NZ_CP011663.1 Clostridium sporogenes
452 613538 613738 + NC_009828.1 Pseudothermotoga lettingae TMO
453 606701 606901 + NC_022792.1 Pseudothermotoga elfii DSM 9442 = NBRC 107921
454 405177 405344 - NZ_AP021898.1 Akkermansia muciniphila
455 725826 726026 - NC_015707.1 Pseudothermotoga thermarum DSM 5069
456 293777 293971 + NZ_CP018180.1 Liquorilactobacillus nagelii
457 1219285 1219446 - NC_009718.1 Fervidobacterium nodosum Rt17-B1
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_008554.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF03947.20 0.96 437 1825.0 same-strand Ribosomal Proteins L2, C-terminal domain
2 PF00181.25 0.96 437 1825.0 same-strand Ribosomal Proteins L2, RNA binding domain
3 PF00203.23 0.97 443 1503.5 same-strand Ribosomal protein S19
4 PF00237.21 0.97 442 1121 same-strand Ribosomal protein L22p/L17e
5 PF00189.22 0.98 449 427.0 same-strand Ribosomal protein S3, C-terminal domain
6 PF07650.19 0.98 449 427.0 same-strand KH domain
7 PF00252.20 0.99 452 0 same-strand Ribosomal protein L16p/L10e
8 PF00366.22 1.0 455 17.0 same-strand Ribosomal protein S17
9 PF00238.21 0.94 429 336.0 same-strand Ribosomal protein L14p/L23e
10 PF17136.6 0.89 408 739 same-strand Ribosomal proteins 50S L24/mitochondrial 39S L24
11 PF00467.31 0.91 416 738 same-strand KOW motif
12 PF00673.23 0.93 422 1078 same-strand ribosomal L5P family C-terminus
13 PF00281.21 0.93 422 1078 same-strand Ribosomal protein L5
14 PF00253.23 0.83 379 1640.0 same-strand Ribosomal protein S14p/S29e
++ More..