Result : Q97P39
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0337 protein SP_1805 |
| NCBI Accession ID | AE005672.3 |
| Organism | Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4) |
| Left | 1720276 |
| Right | 1720479 |
| Strand | + |
| Nucleotide Sequence | ATGTCAGTAGAAGAAAAATTAAATCAAGCTAAAGGTTCTATTAAAGAAGGTGTTGGGAAAGCCATCGGTGATGAAAAAATGGAAAAAGAAGGTGCAGCTGAAAAAGTTGTTTCTAAAGTAAAAGAAGTTGCCGAAGACGCTAAAGACGCTGTAGAAGGTGCTGTAGAAGGTGTTAAAAACATGTTGAGTGGCGACGATAAATAA |
| Sequence | MSVEEKLNQAKGSIKEGVGKAIGDEKMEKEGAAEKVVSKVKEVAEDAKDAVEGAVEGVKNMLSGDDK |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl22912. Profile Description: CsbD-like. hypothetical protein; Provisional |
| Pubmed ID | 11463916 |
| Domain | CDD:419889 |
| Functional Category | Others |
| Uniprot ID | Q97P39 |
| ORF Length (Amino Acid) | 67 |
++ More..
| Conservation Analysis |
No. of Species: 28
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1333061 | 1333264 | + | NZ_CP032621.1 | Streptococcus gwangjuense |
| 2 | 1161787 | 1161978 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 3 | 1473441 | 1473644 | + | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 4 | 1320485 | 1320685 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 5 | 1771254 | 1771460 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 6 | 1644543 | 1644746 | + | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 7 | 1895096 | 1895299 | + | NZ_LR594049.1 | Streptococcus gordonii |
| 8 | 401601 | 401804 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 9 | 1738440 | 1738643 | + | NZ_LS483403.1 | Streptococcus lutetiensis |
| 10 | 1889384 | 1889587 | + | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 11 | 1306597 | 1306791 | + | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 12 | 698049 | 698252 | + | NZ_CP046314.1 | Gemella morbillorum |
| 13 | 938203 | 938406 | - | NZ_CP032620.1 | Streptococcus koreensis |
| 14 | 1816532 | 1816732 | + | NZ_CP032364.1 | Lachnoanaerobaculum umeaense |
| 15 | 1181653 | 1181856 | + | NZ_CP029491.1 | Streptococcus sobrinus |
| 16 | 1438505 | 1438702 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 17 | 1281255 | 1281449 | + | NZ_LR134275.1 | Streptococcus vestibularis |
| 18 | 412519 | 412755 | + | NZ_LT906470.1 | Veillonella rodentium |
| 19 | 1823348 | 1823539 | - | NZ_LR134484.1 | Gemella haemolysans |
| 20 | 410343 | 410579 | + | NZ_LR778174.1 | Veillonella parvula |
| 21 | 70209 | 70409 | + | NZ_CP013237.1 | Streptococcus mutans |
| 22 | 605812 | 605994 | - | NZ_CP054015.1 | Streptococcus gallolyticus |
| 23 | 1571810 | 1572022 | + | NZ_AP018400.1 | Streptococcus ruminantium |
| 24 | 1179735 | 1179926 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 25 | 1970015 | 1970224 | - | NZ_CP039457.1 | Streptococcus pasteurianus |
| 26 | 1077198 | 1077368 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 27 | 818262 | 818441 | + | NZ_LS483343.1 | Streptococcus ferus |
| 28 | 182933 | 183148 | + | NZ_LS483343.1 | Streptococcus ferus |
| 29 | 1457708 | 1457896 | + | NZ_CP053988.1 | Abiotrophia defectiva |
| 30 | 1727848 | 1728027 | + | NZ_LT906439.1 | Streptococcus merionis |
| 31 | 1603795 | 1604007 | + | NC_012924.1 | Streptococcus suis SC84 |
| 32 | 934801 | 935001 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 33 | 1612588 | 1612788 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 34 | 1048173 | 1048367 | - | NZ_CP025536.1 | Streptococcus pluranimalium |
| 35 | 1240011 | 1240196 | - | NZ_CP045927.1 | Staphylococcus agnetis |
| 36 | 812483 | 812686 | - | NZ_CP065637.1 | Lactococcus garvieae |
++ More..