| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative ankyrin repeat protein RC0956 |
| NCBI Accession ID | AE006914.1 |
| Organism | Rickettsia conorii (strain ATCC VR-613 / Malish 7) |
| Left | 895599 |
| Right | 895832 |
| Strand | + |
| Nucleotide Sequence | ATGCAAACGATTAACGGCAATACAGATATATCACCTTTAATGCTTGCATCAGAGTATGGGCAGGTCACAATAGTAAAATATTTACTTAAACACGGTAACTATAATGTTAAAGGATGGGAAAAAGATAACTTACATAGCGATGTATCGTGTCAACTCACTCAAATCACTGAGATTTCTACATTGTGTGAAAAAGCTAATAATCCTAACCACCAATACATATTAGAGACGATATGA |
| Sequence | MQTINGNTDISPLMLASEYGQVTIVKYLLKHGNYNVKGWEKDNLHSDVSCQLTQITEISTLCEKANNPNHQYILETI |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl02529. Profile Description: Ankyrin repeat. Ankyrins are multifunctional adaptors that link specific proteins to the membrane-associated, spectrin- actin cytoskeleton. This repeat-domain is a 'membrane-binding' domain of up to 24 repeated units, and it mediates most of the protein's binding activities. |
| Pubmed ID | 11557893 |
| Domain | CDD:413359 |
| Functional Category | Others |
| Uniprot ID | Q92H16 |
| ORF Length (Amino Acid) | 77 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 895599 | 895832 | + | NC_003103.1 | Rickettsia conorii str. Malish 7 |
| 2 | 903127 | 903321 | + | NC_016639.1 | Rickettsia slovaca 13-B |
| 3 | 898619 | 898813 | + | NC_010263.3 | Rickettsia rickettsii str. Iowa |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00133.24 | 1.0 | 3 | 872 | same-strand | tRNA synthetases class I (I, L, M and V) |
| 2 | PF19302.1 | 1.0 | 3 | 872 | same-strand | Domain of unknown function (DUF5915) |
| 3 | PF08264.15 | 1.0 | 3 | 872 | same-strand | Anticodon-binding domain of tRNA ligase |
| 4 | PF13174.8 | 1.0 | 3 | 707 | same-strand | Tetratricopeptide repeat |
| 5 | PF02786.19 | 1.0 | 3 | 1237 | opposite-strand | Carbamoyl-phosphate synthase L chain, ATP binding domain |
| 6 | PF00289.24 | 1.0 | 3 | 1237 | opposite-strand | Biotin carboxylase, N-terminal domain |
| 7 | PF02785.21 | 1.0 | 3 | 1237 | opposite-strand | Biotin carboxylase C-terminal domain |
| 8 | PF18140.3 | 1.0 | 3 | 1237 | opposite-strand | Propionyl-coenzyme A carboxylase BT domain |
| 9 | PF00364.24 | 1.0 | 3 | 1237 | opposite-strand | Biotin-requiring enzyme |
| 10 | PF02222.24 | 1.0 | 3 | 1237 | opposite-strand | ATP-grasp domain |
| 11 | PF08443.13 | 1.0 | 3 | 1237 | opposite-strand | RimK-like ATP-grasp domain |
| 12 | PF02655.16 | 1.0 | 3 | 1237 | opposite-strand | ATP-grasp domain |
| 13 | PF01039.24 | 1.0 | 3 | 3332 | opposite-strand | Carboxyl transferase domain |
| 14 | PF00501.30 | 1.0 | 3 | 5428 | same-strand | AMP-binding enzyme |
| 15 | PF07690.18 | 1.0 | 3 | 5428 | same-strand | Major Facilitator Superfamily |
| 16 | PF01553.23 | 1.0 | 3 | 5428 | same-strand | Acyltransferase |