Result : Q8X3T6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Small toxic protein ZorP |
| NCBI Accession ID | AE005174.2 |
| Organism | Escherichia coli O157:H7 |
| Left | 2953979 |
| Right | 2954068 |
| Strand | - |
| Nucleotide Sequence | ATGGACTCGCTGACACAAAAGTTAACCGTGCTCATTGCTGTACTGGAGCTATTAGTAGCTCTGTTACGGTTGATTGATTTGTTGAAGTAA |
| Sequence | MDSLTQKLTVLIAVLELLVALLRLIDLLK |
| Source of smORF | Swiss-Prot |
| Function | Toxic component of a type I toxin-antitoxin (TA) system. Overexpression leads to cell stasis and a decrease in colony-forming units (Pubmed:20156992). Probably repressed by cognate small RNA orzP. Base pairing occurs between 18 bases in the 5' UTR of zorP mRNA and the 5' end of OrzP sRNA (Probable). {ECO:0000269|Pubmed:20156992, ECO:0000305|Pubmed:24203704}. |
| Pubmed ID | 11206551 20156992 24203704 |
| Domain | |
| Functional Category | Toxin_type_1 |
| Uniprot ID | Q8X3T6 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2883883 | 2883972 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2883274 | 2883363 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 2208320 | 2208409 | - | NZ_AP014857.1 | Escherichia albertii |
| 4 | 2213517 | 2213606 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 1203114 | 1203203 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 1202506 | 1202595 | - | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP014857.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05406.17 | 0.75 | 3 | 6442 | opposite-strand | WGR domain |
| 2 | PF13569.8 | 1.0 | 4 | 4475.5 | opposite-strand | Domain of unknown function (DUF4132) |
| 3 | PF07728.16 | 1.0 | 4 | 435.0 | opposite-strand | AAA domain (dynein-related subfamily) |
| 4 | PF05762.16 | 1.0 | 4 | 3805.5 | opposite-strand | VWA domain containing CoxE-like protein |
| 5 | PF13519.8 | 1.0 | 4 | 3805.5 | opposite-strand | von Willebrand factor type A domain |
| 6 | PF18934.2 | 0.75 | 3 | 1533.5 | opposite-strand | Family of unknown function (DUF5682) |
++ More..