Protein Information |
Information Type | Description |
---|---|
Protein name | Citrate lyase acyl carrier protein (Citrate lyase gamma chain) |
NCBI Accession ID | AE009951.2 |
Organism | Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355) |
Left | 2026202 |
Right | 2026486 |
Strand | + |
Nucleotide Sequence | ATGGTTTTAAAAACTGTTGGTGTTGCTGGAACATTAGAATCTAGTGATGCAATGATAACTGTTGAACCTGCCAATCAAGGTGGAATTGTTATTGATATTTCAAGTTCAGTTAAAAGACAATTTGGTAGACAAATTGAAGAAACTGTACTTAACACTATAAAAGAATTAGGTGTTGAAAATGCTAATGTAAAAGTTGTAGATAAGGGTGCATTAAATTATGCTCTTATAGCTAGAACTAAAGCTGCTGTATATAGAGCTGCTGAATCTAATGATTATAAATTTTAG |
Sequence | MVLKTVGVAGTLESSDAMITVEPANQGGIVIDISSSVKRQFGRQIEETVLNTIKELGVENANVKVVDKGALNYALIARTKAAVYRAAESNDYKF |
Source of smORF | Swiss-Prot |
Function | Covalent carrier of the coenzyme of citrate lyase. {ECO:0000255|HAMAP-Rule:MF_00805}. |
Pubmed ID | 11889109 |
Domain | CDD:414649 |
Functional Category | Others |
Uniprot ID | Q8RDW6 |
ORF Length (Amino Acid) | 94 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2035383 | 2035667 | + | NZ_CP068114.1 | Fusobacterium canifelinum |
2 | 1996640 | 1996924 | + | NZ_LN831027.1 | Fusobacterium nucleatum subsp. polymorphum |
3 | 1057583 | 1057867 | - | NZ_CP013336.1 | Fusobacterium hwasookii ChDC F206 |
4 | 1091155 | 1091439 | - | NZ_CP024699.1 | Fusobacterium pseudoperiodonticum |
5 | 145799 | 146080 | + | NZ_LR134524.1 | Peptoniphilus harei |
6 | 1699538 | 1699843 | - | NZ_LR594050.1 | Streptococcus porcinus |
7 | 1747454 | 1747762 | - | NZ_CP043405.1 | Streptococcus ratti |
8 | 1485882 | 1486187 | + | NZ_LR134341.1 | Streptococcus pseudoporcinus |
9 | 1086565 | 1086861 | - | NZ_CP029477.1 | Lactobacillus kullabergensis |
10 | 492320 | 492619 | - | NC_013740.1 | Acidaminococcus fermentans DSM 20731 |
11 | 1323938 | 1324231 | - | NZ_CP059829.1 | Lactobacillus ultunensis |
12 | 521494 | 521793 | - | NZ_CP017713.1 | Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 |
13 | 1237211 | 1237468 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
14 | 69761 | 70003 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
15 | 612720 | 613013 | - | NZ_CP012033.1 | Levilactobacillus koreensis |
16 | 1120222 | 1120512 | + | NZ_CP032757.1 | Lactiplantibacillus pentosus |
17 | 1286565 | 1286819 | + | NZ_CP060715.1 | Erysipelothrix inopinata |
18 | 678450 | 678713 | + | NZ_CP014176.1 | Clostridium argentinense |
19 | 2929192 | 2929437 | - | NZ_LS483250.1 | Moritella yayanosii |
20 | 2032582 | 2032872 | + | NZ_CP013213.1 | Erysipelothrix larvae |
21 | 940443 | 940730 | + | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
22 | 1697858 | 1698130 | + | NZ_CP011786.1 | Bifidobacterium actinocoloniiforme DSM 22766 |
23 | 1042094 | 1042354 | - | NZ_CP068055.1 | Sutterella wadsworthensis |
24 | 1072382 | 1072669 | + | NZ_CP009610.1 | Haemophilus influenzae |
25 | 1876239 | 1876526 | - | NZ_LS483429.1 | Haemophilus aegyptius |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03328.16 | 1.0 | 25 | -3 | same-strand | HpcH/HpaI aldolase/citrate lyase family |
2 | PF04223.14 | 1.0 | 25 | 894 | same-strand | Citrate lyase, alpha subunit (CitF) |
3 | PF08218.13 | 0.64 | 16 | 45.5 | same-strand | Citrate lyase ligase C-terminal domain |
4 | PF03802.16 | 0.68 | 17 | 2421 | same-strand | Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase |