Result : Q8KRV3
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ATP synthase subunit c, sodium ion specific (ATP synthase F(0) sector subunit c) (F-type ATPase subunit c) (F-ATPase subunit c) (Lipid-binding protein) |
| NCBI Accession ID | AF522463.1 |
| Organism | Ilyobacter tartaricus |
| Left | 1613 |
| Right | 1882 |
| Strand | + |
| Nucleotide Sequence | ATGGATATGTTATTTGCTAAAACGGTAGTATTGGCAGCATCGGCTGTAGGTGCTGGAACAGCAATGATCGCAGGTATTGGACCAGGGGTAGGACAAGGATACGCAGCTGGTAAAGCGGTAGAATCAGTAGCTAGACAACCAGAAGCAAAAGGGGACATCATCTCTACAATGGTACTAGGACAAGCCGTTGCGGAATCAACAGGTATCTACTCACTAGTTATTGCTCTAATCCTACTTTATGCTAACCCATTTGTCGGATTATTAGGATAA |
| Sequence | MDMLFAKTVVLAASAVGAGTAMIAGIGPGVGQGYAAGKAVESVARQPEAKGDIISTMVLGQAVAESTGIYSLVIALILLYANPFVGLLG |
| Source of smORF | Swiss-Prot |
| Function | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane sodium channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to sodium translocation.; Key component of the F(0) channel; it plays a direct role in translocation across the membrane. A homomeric c-ring of 11 subunits forms the central stalk rotor element with the F(1) delta and epsilon subunits. |
| Pubmed ID | 12531483 15860619 |
| Domain | CDD:412393 |
| Functional Category | Others |
| Uniprot ID | Q8KRV3 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 74
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 231934 | 232203 | + | NC_014632.1 | Ilyobacter polytropus DSM 2926 |
| 2 | 1180347 | 1180610 | + | NZ_CP028103.1 | Fusobacterium varium ATCC 27725 |
| 3 | 2352459 | 2352713 | + | NZ_CP028103.1 | Fusobacterium varium ATCC 27725 |
| 4 | 1505727 | 1505990 | + | NZ_CP028105.1 | Fusobacterium ulcerans |
| 5 | 2694015 | 2694254 | + | NZ_CP028105.1 | Fusobacterium ulcerans |
| 6 | 293083 | 293355 | - | NZ_CP028102.1 | Fusobacterium mortiferum ATCC 9817 |
| 7 | 2258409 | 2258678 | - | NZ_CP013336.1 | Fusobacterium hwasookii ChDC F206 |
| 8 | 832556 | 832825 | - | NZ_LN831027.1 | Fusobacterium nucleatum subsp. polymorphum |
| 9 | 946611 | 946880 | - | NZ_CP068114.1 | Fusobacterium canifelinum |
| 10 | 2112596 | 2112865 | + | NZ_CP024699.1 | Fusobacterium pseudoperiodonticum |
| 11 | 495853 | 496116 | + | NZ_CP028107.1 | Fusobacterium necrophorum subsp. funduliforme |
| 12 | 99226 | 99489 | - | NZ_CP028106.1 | Fusobacterium gonidiaformans ATCC 25563 |
| 13 | 385990 | 386256 | + | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 14 | 385608 | 385892 | + | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 15 | 2767488 | 2767754 | - | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 16 | 2331433 | 2331699 | - | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 17 | 2331827 | 2332108 | - | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 18 | 215640 | 215906 | + | NZ_CP020559.1 | Clostridium formicaceticum |
| 19 | 215186 | 215470 | + | NZ_CP020559.1 | Clostridium formicaceticum |
| 20 | 347771 | 348037 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 21 | 230932 | 231198 | + | NZ_CP009687.1 | Clostridium aceticum |
| 22 | 230486 | 230770 | + | NZ_CP009687.1 | Clostridium aceticum |
| 23 | 880010 | 880264 | + | NZ_HF545616.1 | Ruminococcus bicirculans |
| 24 | 2254520 | 2254774 | - | NC_014614.1 | Acetoanaerobium sticklandii |
| 25 | 303760 | 304020 | - | NC_014833.1 | Ruminococcus albus 7 = DSM 20455 |
| 26 | 1912923 | 1913174 | - | NC_011899.1 | Halothermothrix orenii H 168 |
| 27 | 2162302 | 2162559 | - | NC_017455.1 | Halanaerobium praevalens DSM 2228 |
| 28 | 2163098 | 2163355 | - | NC_017455.1 | Halanaerobium praevalens DSM 2228 |
| 29 | 2593559 | 2593822 | - | NZ_CP016379.1 | Anoxybacter fermentans |
| 30 | 935552 | 935812 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 31 | 935894 | 936118 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 32 | 147250 | 147486 | + | NZ_LR134523.1 | Peptoniphilus ivorii |
| 33 | 2000279 | 2000569 | + | NZ_LR130778.1 | Petrocella atlantisensis |
| 34 | 1999932 | 2000207 | + | NZ_LR130778.1 | Petrocella atlantisensis |
| 35 | 3950127 | 3950408 | - | NC_015275.1 | Cellulosilyticum lentocellum DSM 5427 |
| 36 | 3950534 | 3950806 | - | NC_015275.1 | Cellulosilyticum lentocellum DSM 5427 |
| 37 | 249734 | 249982 | + | NC_016894.1 | Acetobacterium woodii DSM 1030 |
| 38 | 250039 | 250287 | + | NC_016894.1 | Acetobacterium woodii DSM 1030 |
| 39 | 2445923 | 2446189 | + | NZ_CP070062.1 | Coprococcus comes |
| 40 | 177150 | 177416 | + | NZ_LT635475.1 | Ezakiella massiliensis |
| 41 | 205497 | 205766 | + | NC_018664.1 | Gottschalkia acidurici 9a |
| 42 | 1678831 | 1679049 | - | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 43 | 2476302 | 2476577 | - | NC_019978.1 | Halobacteroides halobius DSM 5150 |
| 44 | 2476015 | 2476266 | - | NC_019978.1 | Halobacteroides halobius DSM 5150 |
| 45 | 458207 | 458464 | + | NC_014654.1 | Halanaerobium hydrogeniformans |
| 46 | 457418 | 457675 | + | NC_014654.1 | Halanaerobium hydrogeniformans |
| 47 | 199521 | 199772 | + | NZ_CP014150.1 | Paeniclostridium sordellii |
| 48 | 1508599 | 1508862 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 49 | 3082529 | 3082789 | - | NC_010718.1 | Natranaerobius thermophilus JW/NM-WN-LF |
| 50 | 2439378 | 2439629 | - | NZ_CP036523.1 | Peptacetobacter hiranonis |
| 51 | 201792 | 202058 | + | NC_014387.1 | Butyrivibrio proteoclasticus B316 |
| 52 | 2003784 | 2004008 | - | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
| 53 | 340241 | 340504 | + | NZ_CP040058.1 | Anaerostipes rhamnosivorans |
| 54 | 3117680 | 3117943 | - | NZ_CP036345.1 | Anaerostipes caccae L1-92 |
| 55 | 3417701 | 3417967 | - | NZ_CP014176.1 | Clostridium argentinense |
| 56 | 2336730 | 2336990 | - | NC_014378.1 | Acetohalobium arabaticum DSM 5501 |
| 57 | 695888 | 696136 | + | NZ_CP011391.1 | Faecalibaculum rodentium |
| 58 | 3477700 | 3477945 | - | NZ_CP021983.2 | Halomicronema hongdechloris C2206 |
| 59 | 2865254 | 2865505 | - | NZ_CP040098.1 | Desulfoglaeba alkanexedens ALDC |
| 60 | 2687736 | 2688017 | + | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 61 | 2131485 | 2131730 | + | NC_019729.1 | Oscillatoria nigro-viridis PCC 7112 |
| 62 | 2140484 | 2140732 | + | NZ_AP019711.1 | Amedibacterium intestinale |
| 63 | 2348487 | 2348741 | - | NC_022600.1 | Gloeobacter kilaueensis JS1 |
| 64 | 594393 | 594623 | - | NZ_CP053187.1 | Turicibacter sanguinis |
| 65 | 340051 | 340302 | + | NZ_CP032364.1 | Lachnoanaerobaculum umeaense |
| 66 | 1648055 | 1648321 | - | NC_012440.1 | Persephonella marina EX-H1 |
| 67 | 3702179 | 3702424 | - | NC_019780.1 | Dactylococcopsis salina PCC 8305 |
| 68 | 1463765 | 1464013 | - | NC_005042.1 | Prochlorococcus marinus subsp. marinus str. CCMP1375 |
| 69 | 3006004 | 3006249 | + | NC_019675.1 | Cyanobium gracile PCC 6307 |
| 70 | 5405342 | 5405590 | + | NC_011768.1 | Desulfatibacillum aliphaticivorans |
| 71 | 5405082 | 5405309 | + | NC_011768.1 | Desulfatibacillum aliphaticivorans |
| 72 | 1450485 | 1450745 | + | NZ_CP054140.1 | Desulfobulbus oligotrophicus |
| 73 | 766262 | 766486 | - | NZ_CP014334.1 | Fervidobacterium islandicum |
| 74 | 3417702 | 3417962 | + | NC_014972.1 | Desulfobulbus propionicus DSM 2032 |
| 75 | 429187 | 429435 | - | NZ_CP061799.1 | Desulfonema limicola |
| 76 | 4252053 | 4252301 | + | NZ_AP021875.1 | Desulfosarcina widdelii |
| 77 | 2218898 | 2219152 | - | NC_008593.1 | Clostridium novyi NT |
| 78 | 2036410 | 2036676 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 79 | 12493 | 12717 | - | NZ_CP008796.1 | Thermodesulfobacterium commune DSM 2178 |
| 80 | 1485699 | 1485917 | + | NC_018025.1 | Desulfomonile tiedjei DSM 6799 |
| 81 | 864975 | 865256 | + | NC_015682.1 | Thermodesulfobacterium geofontis OPF15 |
| 82 | 4594468 | 4594728 | - | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 83 | 3022813 | 3023094 | + | NC_014365.1 | Desulfarculus baarsii DSM 2075 |
| 84 | 3421478 | 3421732 | - | NZ_LR699011.1 | Roseburia hominis |
| 85 | 251405 | 251647 | + | NZ_CP015756.1 | Clostridium estertheticum subsp. estertheticum |
| 86 | 4243928 | 4244155 | - | NZ_LR027880.1 | Roseburia intestinalis L1-82 |
| 87 | 143686 | 143928 | + | NZ_AP017656.1 | Sphingobium cloacae |
| 88 | 4342894 | 4343151 | - | NC_014376.1 | [Clostridium] saccharolyticum WM1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP028102.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03899.17 | 0.85 | 63 | 878 | same-strand | ATP synthase I chain |
| 2 | PF00119.22 | 0.99 | 73 | 96 | same-strand | ATP synthase A chain |
| 3 | PF00430.20 | 0.92 | 68 | 64 | same-strand | ATP synthase B/B' CF(0) |
| 4 | PF00213.20 | 0.82 | 61 | 573.5 | same-strand | ATP synthase delta (OSCP) subunit |
| 5 | PF00006.27 | 0.86 | 64 | 1556.5 | same-strand | ATP synthase alpha/beta family, nucleotide-binding domain |
| 6 | PF00306.29 | 0.86 | 64 | 1142 | same-strand | ATP synthase alpha/beta chain, C terminal domain |
| 7 | PF02874.25 | 0.86 | 64 | 1569 | same-strand | ATP synthase alpha/beta family, beta-barrel domain |
| 8 | PF00231.21 | 0.85 | 63 | 2679.5 | same-strand | ATP synthase |
| 9 | PF09527.12 | 0.7 | 52 | 1326.5 | same-strand | Putative F0F1-ATPase subunit Ca2+/Mg2+ transporter |
++ More..