Result : Q8E531
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | UPF0337 protein gbs1203 |
| NCBI Accession ID | AL766849.1 |
| Organism | Streptococcus agalactiae serotype III (strain NEM316) |
| Left | 58496 |
| Right | 58693 |
| Strand | - |
| Nucleotide Sequence | ATGTCTGAAGAAAAATTTGATGCAAAAGTTGATAAGGTTTCTGGTTCAGTAAAAGAATCTGTTGGGAAACTTACTGGCGATAAAGAAGTTGAATCTGAAGGTAAAGTCGATAAATTGAAAGGTCATGCAAAAGAAAAACTTGCTGACATTAAAGATACCATTAAGGGTGCTTCAGAGAGCTTTAAGAAAAAGGACTAG |
| Sequence | MSEEKFDAKVDKVSGSVKESVGKLTGDKEVESEGKVDKLKGHAKEKLADIKDTIKGASESFKKKD |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl22912. Profile Description: CsbD-like. hypothetical protein; Provisional |
| Pubmed ID | 12354221 |
| Domain | CDD:419889 |
| Functional Category | Others |
| Uniprot ID | Q8E531 |
| ORF Length (Amino Acid) | 65 |
++ More..
| Conservation Analysis |
No. of Species: 25
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1122436 | 1122633 | - | NZ_LR134512.1 | Streptococcus agalactiae |
| 2 | 488923 | 489126 | + | NZ_CP014835.1 | Streptococcus halotolerans |
| 3 | 1048173 | 1048367 | - | NZ_CP025536.1 | Streptococcus pluranimalium |
| 4 | 182933 | 183148 | + | NZ_LS483343.1 | Streptococcus ferus |
| 5 | 818262 | 818441 | + | NZ_LS483343.1 | Streptococcus ferus |
| 6 | 1603795 | 1604007 | + | NC_012924.1 | Streptococcus suis SC84 |
| 7 | 934801 | 935001 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 8 | 289116 | 289319 | - | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 9 | 1571810 | 1572022 | + | NZ_AP018400.1 | Streptococcus ruminantium |
| 10 | 1179735 | 1179926 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 11 | 1132754 | 1132960 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 12 | 1190899 | 1191096 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 13 | 887540 | 887743 | + | NZ_LR594050.1 | Streptococcus porcinus |
| 14 | 1716800 | 1716997 | - | NZ_LR134293.1 | Streptococcus canis |
| 15 | 1661335 | 1661541 | - | NZ_LR134293.1 | Streptococcus canis |
| 16 | 1727848 | 1728027 | + | NZ_LT906439.1 | Streptococcus merionis |
| 17 | 3142398 | 3142610 | + | NZ_CP023564.1 | Brachybacterium ginsengisoli |
| 18 | 2439463 | 2439675 | - | NZ_CP022316.1 | Brachybacterium avium |
| 19 | 1403139 | 1403351 | + | NZ_LS483405.1 | Levilactobacillus brevis |
| 20 | 382531 | 382722 | + | NZ_CP031733.1 | Streptococcus chenjunshii |
| 21 | 1773177 | 1773359 | - | NZ_CP032757.1 | Lactiplantibacillus pentosus |
| 22 | 1308735 | 1308947 | + | NC_016605.1 | Pediococcus claussenii ATCC BAA-344 |
| 23 | 1316263 | 1316427 | + | NZ_CP008747.1 | Staphylococcus hyicus |
| 24 | 276296 | 276514 | + | NZ_CP042410.1 | Leuconostoc citreum |
| 25 | 720476 | 720691 | + | NZ_CP044499.1 | Lapidilactobacillus dextrinicus |
| 26 | 142070 | 142246 | + | NZ_CP018180.1 | Liquorilactobacillus nagelii |
| 27 | 678694 | 678873 | - | NZ_LN606600.1 | Acetobacter senegalensis |
| 28 | 1843536 | 1843724 | + | NZ_CP040586.1 | Furfurilactobacillus rossiae |
| 29 | 115917 | 116090 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
++ More..