Result : Q839Z0
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S6 |
| NCBI Accession ID | AE016830.1 |
| Organism | Enterococcus faecalis (strain ATCC 700802 / V583) |
| Left | 9350 |
| Right | 9652 |
| Strand | + |
| Nucleotide Sequence | ATGAGTCAAGATACGAAGTACGAAATCATGTACATTATTCGTCCGAACATTGATGAAGAAGCAAAAACTGCTTTAGTAGAACGTTTCGACACAATCTTAAAAGATAACGGAGCAGAAGTTATCGAATCTAAAGATTGGGAAAAACGCCGCTTAGCATATGAAATGAACGGATTCCGTGAAGGCATCTATCATATCGTTAATGTTACTTCTCCATCAACAGCTGGCGCAATCAACGAGTTTGATCGTTTAGCAAAAATCAATGACGATATTATCCGTCATATGATCGTGAAGGTAGAAGCATAA |
| Sequence | MSQDTKYEIMYIIRPNIDEEAKTALVERFDTILKDNGAEVIESKDWEKRRLAYEMNGFREGIYHIVNVTSPSTAGAINEFDRLAKINDDIIRHMIVKVEA |
| Source of smORF | Swiss-Prot |
| Function | Binds together with S18 to 16S ribosomal RNA. {ECO:0000255|HAMAP-Rule:MF_00360}. |
| Pubmed ID | 12663927 |
| Domain | CDD:412366 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | Q839Z0 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 288
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2536541 | 2536843 | + | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 2 | 3073466 | 3073741 | + | NZ_CP018061.1 | Enterococcus mundtii |
| 3 | 654929 | 655204 | - | NZ_CP023011.2 | Enterococcus hirae |
| 4 | 8877 | 9152 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 5 | 8939 | 9214 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 6 | 12850 | 13125 | + | NZ_AP022822.1 | Enterococcus saigonensis |
| 7 | 9316 | 9591 | + | NZ_CP065211.1 | Enterococcus lactis |
| 8 | 9057 | 9356 | + | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 9 | 8862 | 9137 | + | NZ_CP012047.1 | Tetragenococcus halophilus |
| 10 | 924500 | 924799 | - | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 11 | 11098 | 11397 | + | NZ_CP017267.1 | Vagococcus teuberi |
| 12 | 255597 | 255896 | + | NZ_CP016843.1 | Carnobacterium divergens |
| 13 | 14159 | 14458 | + | NZ_LS483306.1 | Enterococcus cecorum |
| 14 | 1998638 | 1998931 | - | NZ_CP032627.1 | Lactococcus allomyrinae |
| 15 | 2329783 | 2330076 | - | NC_022369.1 | Lactococcus lactis subsp. cremoris KW2 |
| 16 | 147862 | 148161 | - | NZ_CP060720.1 | Vagococcus carniphilus |
| 17 | 124914 | 125207 | - | NZ_CP070872.1 | Lactococcus taiwanensis |
| 18 | 434981 | 435280 | - | NZ_CP049886.1 | Vagococcus coleopterorum |
| 19 | 1776564 | 1776863 | - | NZ_CP017194.1 | Lactococcus carnosus |
| 20 | 1055796 | 1056098 | - | NZ_CP049887.1 | Vagococcus hydrophili |
| 21 | 9297 | 9596 | + | NZ_CP039712.1 | Vagococcus zengguangii |
| 22 | 359886 | 360185 | + | NZ_CP017195.1 | Lactococcus paracarnosus |
| 23 | 736299 | 736598 | - | NZ_CP023392.1 | Lactococcus raffinolactis |
| 24 | 9595 | 9894 | + | NZ_CP017713.1 | Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 |
| 25 | 1671432 | 1671722 | - | NZ_LR594050.1 | Streptococcus porcinus |
| 26 | 1515119 | 1515409 | + | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 27 | 1836363 | 1836653 | - | NZ_CP029491.1 | Streptococcus sobrinus |
| 28 | 1456718 | 1457008 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 29 | 1822511 | 1822801 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 30 | 1682646 | 1682936 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 31 | 884056 | 884346 | + | NZ_LR134293.1 | Streptococcus canis |
| 32 | 153414 | 153704 | + | NZ_CP014699.1 | Streptococcus pantholopis |
| 33 | 1713524 | 1713814 | - | NZ_CP025536.1 | Streptococcus pluranimalium |
| 34 | 2886355 | 2886654 | + | NZ_CP030105.1 | Lactiplantibacillus plantarum |
| 35 | 10712 | 11011 | + | NZ_CP032757.1 | Lactiplantibacillus pentosus |
| 36 | 1690999 | 1691289 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 37 | 1707490 | 1707780 | - | NZ_LR134275.1 | Streptococcus vestibularis |
| 38 | 1577365 | 1577655 | - | NZ_LS483343.1 | Streptococcus ferus |
| 39 | 878929 | 879228 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 40 | 1644441 | 1644731 | - | NZ_CP012805.1 | Streptococcus anginosus |
| 41 | 416432 | 416725 | + | NZ_CP065637.1 | Lactococcus garvieae |
| 42 | 1958632 | 1958922 | + | NZ_CP014835.1 | Streptococcus halotolerans |
| 43 | 965327 | 965623 | - | NZ_CP042371.1 | Secundilactobacillus malefermentans |
| 44 | 1818605 | 1818895 | - | NZ_CP039457.1 | Streptococcus pasteurianus |
| 45 | 1287674 | 1287964 | - | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 46 | 1577460 | 1577750 | - | NZ_CP034543.1 | Streptococcus periodonticum |
| 47 | 1010641 | 1010931 | + | NZ_CP032620.1 | Streptococcus koreensis |
| 48 | 453889 | 454179 | - | NZ_CP054015.1 | Streptococcus gallolyticus |
| 49 | 1726932 | 1727222 | - | NZ_LT906439.1 | Streptococcus merionis |
| 50 | 442424 | 442714 | + | NZ_CP031733.1 | Streptococcus chenjunshii |
| 51 | 943415 | 943705 | + | NZ_CP043405.1 | Streptococcus ratti |
| 52 | 1506869 | 1507159 | - | NZ_LS483403.1 | Streptococcus lutetiensis |
| 53 | 1882047 | 1882337 | + | NZ_CP013237.1 | Streptococcus mutans |
| 54 | 1941328 | 1941618 | - | NZ_LR594049.1 | Streptococcus gordonii |
| 55 | 301873 | 302163 | + | NZ_AP014612.1 | Streptococcus troglodytae |
| 56 | 1045247 | 1045537 | - | NZ_CP049740.1 | Jeotgalibaca arthritidis |
| 57 | 299831 | 300121 | + | NZ_LS483436.1 | Streptococcus intermedius |
| 58 | 1636343 | 1636630 | - | NZ_LR134512.1 | Streptococcus agalactiae |
| 59 | 1693849 | 1694139 | - | NZ_AP018400.1 | Streptococcus ruminantium |
| 60 | 1445504 | 1445794 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 61 | 1332928 | 1333218 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 62 | 1696329 | 1696619 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 63 | 663040 | 663330 | + | NZ_CP022680.1 | Streptococcus respiraculi |
| 64 | 1838904 | 1839194 | - | NZ_CP019728.1 | Jeotgalibaca dankookensis |
| 65 | 1168683 | 1168973 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 66 | 926330 | 926620 | + | NZ_CP016953.1 | Streptococcus himalayensis |
| 67 | 1231628 | 1231924 | - | NZ_CP012033.1 | Levilactobacillus koreensis |
| 68 | 9313 | 9603 | + | NZ_CP011403.1 | Ligilactobacillus salivarius str. Ren |
| 69 | 542020 | 542310 | - | NZ_CP015196.1 | Streptococcus marmotae |
| 70 | 1201157 | 1201447 | + | NZ_CP049889.1 | Jeotgalibaca porci |
| 71 | 1022409 | 1022711 | - | NZ_CP014163.1 | Aerococcus urinaehominis |
| 72 | 9749 | 10045 | + | NZ_LS483405.1 | Levilactobacillus brevis |
| 73 | 1731395 | 1731685 | - | NC_012924.1 | Streptococcus suis SC84 |
| 74 | 10080 | 10376 | + | NZ_AP012544.1 | Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 |
| 75 | 2973572 | 2973868 | + | NZ_LS991421.1 | Lacticaseibacillus zeae |
| 76 | 3280879 | 3281151 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 77 | 13080 | 13331 | + | NC_014334.2 | Lacticaseibacillus paracasei |
| 78 | 846910 | 847206 | - | NZ_CP018906.1 | Lentilactobacillus curieae |
| 79 | 10112 | 10411 | + | NZ_CP040586.1 | Furfurilactobacillus rossiae |
| 80 | 1082620 | 1082907 | - | NZ_CP014912.1 | Secundilactobacillus paracollinoides |
| 81 | 7669 | 7920 | + | NZ_CP018180.1 | Liquorilactobacillus nagelii |
| 82 | 49606 | 49878 | + | NC_003210.1 | Listeria monocytogenes EGD-e |
| 83 | 9978 | 10268 | + | NZ_CP047141.1 | Ligilactobacillus animalis |
| 84 | 2346562 | 2346834 | - | NZ_CP054482.1 | Macrococcus bohemicus |
| 85 | 34261 | 34533 | + | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 86 | 35504 | 35776 | + | NZ_LT906444.1 | Listeria welshimeri |
| 87 | 103041 | 103313 | + | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 88 | 9757 | 10047 | + | NC_016605.1 | Pediococcus claussenii ATCC BAA-344 |
| 89 | 1452823 | 1453083 | - | NZ_CP061835.1 | Weissella viridescens |
| 90 | 10168 | 10470 | + | NZ_CP045562.1 | Fructilactobacillus fructivorans |
| 91 | 8934 | 9233 | + | NZ_CP045563.1 | Fructilactobacillus sanfranciscensis |
| 92 | 1950935 | 1951237 | + | NZ_CP014161.1 | Aerococcus urinae |
| 93 | 3354457 | 3354726 | - | NZ_CP012024.1 | Bacillus smithii |
| 94 | 9117 | 9413 | + | NZ_CP045007.1 | Latilactobacillus graminis |
| 95 | 4591904 | 4592173 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 96 | 4199445 | 4199714 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 97 | 1722589 | 1722861 | - | NZ_CP065729.1 | Macrococcus caseolyticus |
| 98 | 2327953 | 2328225 | - | NZ_CP047361.1 | Macrococcus canis |
| 99 | 305858 | 306154 | - | NZ_CP014872.1 | Fructilactobacillus lindneri |
| 100 | 1533201 | 1533497 | - | NZ_CP031513.1 | Bombilactobacillus bombi |
| 101 | 17520 | 17789 | + | NZ_CP011937.1 | Bacillus velezensis |
| 102 | 4010613 | 4010882 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 103 | 2184680 | 2184949 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 104 | 1972025 | 1972288 | - | NZ_CP027563.1 | Weissella confusa |
| 105 | 751035 | 751331 | + | NZ_CP059603.1 | Levilactobacillus suantsaii |
| 106 | 4103376 | 4103645 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 107 | 4029022 | 4029291 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 108 | 11816 | 12085 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 109 | 9057 | 9341 | + | NC_008525.1 | Pediococcus pentosaceus ATCC 25745 |
| 110 | 9326 | 9613 | + | NZ_CP053421.1 | Pediococcus acidilactici |
| 111 | 1033651 | 1033947 | + | NZ_CP029971.1 | Lentilactobacillus kefiri |
| 112 | 1386497 | 1386760 | - | NZ_CP023501.1 | Weissella paramesenteroides |
| 113 | 1661167 | 1661436 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 114 | 3728400 | 3728669 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 115 | 1564766 | 1565035 | + | NZ_CP043404.1 | Bacillus safensis |
| 116 | 769531 | 769827 | + | NZ_CP046037.1 | Latilactobacillus sakei |
| 117 | 4207787 | 4208056 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 118 | 10914 | 11165 | + | NZ_AP014680.1 | Paucilactobacillus hokkaidonensis JCM 18461 |
| 119 | 10551 | 10847 | + | NZ_CP047121.1 | Lentilactobacillus hilgardii |
| 120 | 2843513 | 2843782 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 121 | 4867301 | 4867570 | - | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 122 | 1519423 | 1519719 | - | NZ_CP026116.1 | Latilactobacillus curvatus JCM 1096 = DSM 20019 |
| 123 | 753282 | 753578 | - | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
| 124 | 4014653 | 4014922 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 125 | 2025569 | 2025838 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 126 | 89786 | 90058 | - | NZ_CP053989.1 | Niallia circulans |
| 127 | 1564672 | 1564923 | - | NZ_CP037940.1 | Weissella cryptocerci |
| 128 | 700917 | 701222 | + | NZ_CP014159.1 | Aerococcus christensenii |
| 129 | 8972 | 9268 | + | NZ_LN898144.1 | Paucilactobacillus oligofermentans DSM 15707 = LMG 22743 |
| 130 | 10740 | 11042 | - | NZ_CP013988.1 | Aerococcus urinaeequi |
| 131 | 64914 | 65216 | + | NZ_CP014164.1 | Aerococcus viridans |
| 132 | 119654 | 119923 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 133 | 3995771 | 3996040 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 134 | 4646634 | 4646906 | - | NZ_CP006837.1 | Lysinibacillus varians |
| 135 | 95077 | 95349 | + | NZ_CP019980.1 | Lysinibacillus sphaericus |
| 136 | 33069 | 33341 | + | NZ_LR134483.1 | Listeria grayi |
| 137 | 4364694 | 4364963 | - | NZ_LS483476.1 | Lederbergia lentus |
| 138 | 5132514 | 5132786 | + | NZ_CP040336.1 | Bacillus luti |
| 139 | 2567179 | 2567472 | - | NZ_CP023434.1 | Suicoccus acidiformans |
| 140 | 5237615 | 5237887 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 141 | 5435100 | 5435372 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 142 | 5021175 | 5021444 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 143 | 5406149 | 5406421 | - | NC_011725.1 | Bacillus cereus B4264 |
| 144 | 4896165 | 4896434 | - | NZ_CP042593.1 | Bacillus dafuensis |
| 145 | 292068 | 292346 | + | NC_018631.1 | Leuconostoc gelidum JB7 |
| 146 | 1773692 | 1773988 | - | NZ_CP012034.1 | Companilactobacillus ginsenosidimutans |
| 147 | 5214543 | 5214815 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 148 | 1033494 | 1033790 | - | NZ_CP018796.1 | Lentilactobacillus parabuchneri |
| 149 | 70304 | 70555 | + | NZ_CP017702.1 | Companilactobacillus farciminis KCTC 3681 = DSM 20184 |
| 150 | 2104612 | 2104881 | + | NZ_CP022983.1 | Cytobacillus kochii |
| 151 | 3500927 | 3501199 | - | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 152 | 1954547 | 1954837 | + | NZ_CP019981.1 | Pediococcus inopinatus |
| 153 | 2427239 | 2427505 | - | NZ_CP030926.1 | Peribacillus butanolivorans |
| 154 | 2586053 | 2586319 | + | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 155 | 3990750 | 3991019 | - | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 156 | 4580285 | 4580554 | - | NZ_CP018866.1 | Sutcliffiella cohnii |
| 157 | 298864 | 299127 | + | NZ_CP014332.1 | Weissella jogaejeotgali |
| 158 | 4213653 | 4213922 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 159 | 8973 | 9269 | + | NZ_CP045530.1 | Limosilactobacillus pontis |
| 160 | 2808100 | 2808369 | + | NZ_CP038012.1 | Sporosarcina pasteurii |
| 161 | 250222 | 250491 | + | NZ_CP017560.1 | Sporosarcina ureilytica |
| 162 | 2253616 | 2253867 | - | NZ_CP017996.1 | Companilactobacillus crustorum |
| 163 | 965744 | 966034 | + | NZ_CP012294.1 | Pediococcus damnosus |
| 164 | 1107768 | 1108022 | + | NZ_CP042374.1 | Leuconostoc carnosum |
| 165 | 8938 | 9234 | + | NZ_CP045605.1 | Limosilactobacillus reuteri |
| 166 | 1541881 | 1542135 | - | NZ_CP042410.1 | Leuconostoc citreum |
| 167 | 622494 | 622784 | + | NZ_CP019323.1 | Companilactobacillus allii |
| 168 | 1911254 | 1911523 | + | NZ_CP041305.1 | Cytobacillus ciccensis |
| 169 | 40967 | 41236 | + | NZ_CP010820.1 | Lysinibacillus fusiformis |
| 170 | 283237 | 283533 | + | NZ_CP024610.1 | Lactobacillus terrae |
| 171 | 2208025 | 2208276 | + | NZ_CP049366.1 | Companilactobacillus pabuli |
| 172 | 1795659 | 1795913 | + | NZ_CP028251.1 | Leuconostoc mesenteroides |
| 173 | 1926060 | 1926314 | - | NZ_CP015247.1 | Leuconostoc suionicum |
| 174 | 8993 | 9244 | + | NZ_CP045240.1 | Limosilactobacillus vaginalis |
| 175 | 190565 | 190828 | + | NZ_CP017326.1 | Weissella soli |
| 176 | 4069504 | 4069752 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 177 | 2643065 | 2643316 | - | NZ_CP012559.1 | Companilactobacillus heilongjiangensis |
| 178 | 8946 | 9197 | + | NZ_CP040736.1 | Companilactobacillus futsaii |
| 179 | 849603 | 849857 | + | NC_014136.1 | Leuconostoc kimchii IMSNU 11154 |
| 180 | 3114451 | 3114720 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 181 | 2631637 | 2631930 | + | NZ_CP041364.1 | Schleiferilactobacillus harbinensis |
| 182 | 101190 | 101444 | + | NZ_CP065993.1 | Leuconostoc pseudomesenteroides |
| 183 | 3265789 | 3266058 | - | NZ_CP016538.2 | Planococcus maritimus |
| 184 | 3267818 | 3268087 | - | NZ_CP059540.1 | Planococcus maritimus |
| 185 | 9224 | 9514 | + | NZ_CP044534.1 | Limosilactobacillus frumenti |
| 186 | 3246784 | 3247053 | - | NZ_CP016539.2 | Planococcus plakortidis |
| 187 | 3172742 | 3173011 | - | NZ_CP013659.2 | Planococcus rifietoensis |
| 188 | 3528507 | 3528755 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 189 | 2677742 | 2677990 | - | NZ_CP061470.1 | Geobacillus zalihae |
| 190 | 2412398 | 2412646 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 191 | 291237 | 291485 | + | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 192 | 4294948 | 4295217 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 193 | 1879466 | 1879726 | + | NZ_CP015108.1 | Sporosarcina ureae |
| 194 | 1777800 | 1778069 | + | NZ_CP013661.2 | Planococcus kocurii |
| 195 | 3481174 | 3481443 | - | NZ_CP019401.1 | Planococcus faecalis |
| 196 | 2255950 | 2256225 | + | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 197 | 9478 | 9771 | + | NZ_CP029544.1 | Lactobacillus helsingborgensis |
| 198 | 9255 | 9548 | + | NZ_CP029477.1 | Lactobacillus kullabergensis |
| 199 | 630221 | 630490 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 200 | 1013569 | 1013838 | - | NZ_CP017703.1 | Aeribacillus pallidus |
| 201 | 9365 | 9658 | + | NZ_CP029476.1 | Lactobacillus apis |
| 202 | 3290693 | 3290962 | - | NZ_CP016543.2 | Planococcus donghaensis |
| 203 | 3410041 | 3410310 | - | NZ_CP016537.2 | Planococcus halocryophilus |
| 204 | 2476633 | 2476908 | - | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 205 | 46909 | 47178 | + | NZ_CP014616.1 | Sporosarcina psychrophila |
| 206 | 362344 | 362622 | + | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 207 | 360648 | 360926 | + | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 208 | 497777 | 498046 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 209 | 3750735 | 3751004 | - | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 210 | 3613959 | 3614228 | - | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 211 | 24839 | 25138 | - | NZ_CP011366.1 | Salinicoccus halodurans |
| 212 | 2416483 | 2416758 | - | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 213 | 4314877 | 4315152 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 214 | 2548304 | 2548582 | - | NZ_AP018587.1 | Staphylococcus caprae |
| 215 | 2790355 | 2790603 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 216 | 2361980 | 2362258 | - | NZ_LR134242.1 | Staphylococcus warneri |
| 217 | 1568285 | 1568563 | + | NC_022737.1 | Staphylococcus pasteuri SP1 |
| 218 | 387395 | 387673 | + | NZ_LT906460.1 | Staphylococcus simiae |
| 219 | 79925 | 80215 | - | NZ_CP032626.1 | Apilactobacillus bombintestini |
| 220 | 208340 | 208609 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 221 | 9092 | 9394 | + | NZ_CP044499.1 | Lapidilactobacillus dextrinicus |
| 222 | 2415042 | 2415320 | - | NZ_CP035288.1 | Staphylococcus epidermidis |
| 223 | 2635554 | 2635832 | - | NZ_CP018776.1 | Staphylococcus condimenti |
| 224 | 959133 | 959411 | + | NZ_CP066042.1 | Staphylococcus saccharolyticus |
| 225 | 53752 | 54021 | + | NZ_CP045927.1 | Staphylococcus agnetis |
| 226 | 2438633 | 2438902 | - | NZ_CP008747.1 | Staphylococcus hyicus |
| 227 | 2076441 | 2076719 | - | NZ_LT906464.1 | Staphylococcus muscae |
| 228 | 3244887 | 3245135 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 229 | 154255 | 154548 | - | NZ_CP018809.1 | Lactobacillus jensenii |
| 230 | 1218615 | 1218866 | + | NZ_CP022315.1 | Virgibacillus phasianinus |
| 231 | 172739 | 173017 | - | NZ_CP033460.1 | Staphylococcus debuckii |
| 232 | 2196201 | 2196479 | + | NZ_CP007601.1 | Staphylococcus capitis subsp. capitis |
| 233 | 3235014 | 3235274 | - | NZ_CP016540.2 | Planococcus versutus |
| 234 | 1746196 | 1746483 | - | NZ_CP018199.1 | Staphylococcus succinus |
| 235 | 3781954 | 3782226 | - | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 236 | 2503239 | 2503526 | - | NZ_CP064056.1 | Staphylococcus lloydii |
| 237 | 8926 | 9222 | + | NZ_CP059829.1 | Lactobacillus ultunensis |
| 238 | 160503 | 160790 | + | NZ_CP013114.1 | Staphylococcus equorum |
| 239 | 1150064 | 1150336 | - | NZ_CP023643.1 | Brochothrix thermosphacta |
| 240 | 224136 | 224408 | + | NZ_CP020772.1 | Halobacillus mangrovi |
| 241 | 2618908 | 2619195 | - | NZ_CP008724.1 | Staphylococcus xylosus |
| 242 | 1574769 | 1575020 | + | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 243 | 8933 | 9229 | + | NC_021181.2 | Lactobacillus acidophilus La-14 |
| 244 | 2482727 | 2483014 | - | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 245 | 33294 | 33563 | + | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 246 | 9039 | 9371 | + | NZ_CP034726.1 | Acetilactobacillus jinshanensis |
| 247 | 3713999 | 3714271 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 248 | 2556073 | 2556342 | - | NC_018704.1 | Amphibacillus xylanus NBRC 15112 |
| 249 | 1374855 | 1375133 | - | NZ_CP014022.1 | Staphylococcus lugdunensis |
| 250 | 9148 | 9444 | + | NZ_CP015444.1 | Lactobacillus helveticus |
| 251 | 4121734 | 4122006 | - | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 252 | 9033 | 9329 | + | NZ_CP061341.1 | Lactobacillus kefiranofaciens |
| 253 | 1874154 | 1874441 | + | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 254 | 813359 | 813637 | - | NZ_CP033732.1 | Staphylococcus hominis |
| 255 | 8972 | 9268 | + | NZ_CP044496.1 | Lactobacillus acetotolerans |
| 256 | 550310 | 550579 | - | NZ_CP027770.1 | Staphylococcus felis |
| 257 | 3851016 | 3851267 | - | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 258 | 8918 | 9211 | + | NZ_AP019750.1 | Lactobacillus delbrueckii subsp. delbrueckii |
| 259 | 1348003 | 1348272 | + | NZ_CP020773.1 | Staphylococcus lutrae |
| 260 | 2247811 | 2248083 | + | NZ_CP008876.1 | Terribacillus goriensis |
| 261 | 52966 | 53244 | + | NZ_CP013911.1 | Staphylococcus haemolyticus |
| 262 | 3599265 | 3599537 | - | NZ_CP041666.1 | Radiobacillus deserti |
| 263 | 4665046 | 4665318 | - | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 264 | 4086094 | 4086366 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 265 | 8890 | 9186 | + | NZ_CP059276.1 | Lactobacillus taiwanensis |
| 266 | 323587 | 323838 | + | NZ_CP022437.1 | Virgibacillus necropolis |
| 267 | 172408 | 172674 | + | NZ_CP065712.1 | Staphylococcus auricularis |
| 268 | 9021 | 9317 | + | NC_008530.1 | Lactobacillus gasseri ATCC 33323 = JCM 1131 |
| 269 | 8990 | 9286 | + | NZ_AP018549.1 | Lactobacillus paragasseri |
| 270 | 2731591 | 2731842 | + | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 271 | 1425357 | 1425626 | - | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 272 | 9565 | 9861 | + | NZ_CP031835.1 | Lactobacillus amylolyticus |
| 273 | 27144 | 27416 | + | NZ_CP011361.2 | Salimicrobium jeotgali |
| 274 | 4199816 | 4200088 | - | NZ_CP015378.1 | Fictibacillus phosphorivorans |
| 275 | 1710111 | 1710380 | - | NZ_LR134484.1 | Gemella haemolysans |
| 276 | 3022596 | 3022883 | - | NC_010556.1 | Exiguobacterium sibiricum 255-15 |
| 277 | 142509 | 142796 | - | NZ_CP046314.1 | Gemella morbillorum |
| 278 | 1713849 | 1714139 | - | NZ_CP019573.1 | Abyssicoccus albus |
| 279 | 2602507 | 2602794 | - | NZ_CP040676.1 | Exiguobacterium mexicanum |
| 280 | 3589663 | 3589932 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 281 | 2566251 | 2566520 | - | NZ_CP045798.1 | Thermoanaerosceptrum fracticalcis |
| 282 | 3293087 | 3293374 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 283 | 368773 | 369045 | + | NZ_AP017312.1 | Aneurinibacillus soli |
| 284 | 3843398 | 3843667 | - | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 285 | 4186737 | 4187006 | - | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 286 | 19036 | 19305 | + | NZ_CP012502.1 | Bacillus beveridgei |
| 287 | 3246290 | 3246556 | + | NZ_CP035492.1 | Paenibacillus protaetiae |
| 288 | 8084761 | 8085027 | - | NZ_CP034235.1 | Paenibacillus psychroresistens |
| 289 | 8803755 | 8804021 | - | NC_017672.3 | Paenibacillus mucilaginosus K02 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP021874.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00436.27 | 1.0 | 288 | 37 | same-strand | Single-strand binding protein family |
| 2 | PF01084.22 | 1.0 | 288 | 600 | same-strand | Ribosomal protein S18 |
++ More..