Result : A9BFT2
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | CP000879.1 |
| Organism | Petrotoga mobilis (strain DSM 10674 / SJ95) |
| Left | 756417 |
| Right | 756719 |
| Strand | - |
| Nucleotide Sequence | ATGGAAATAAATACCGAATTAATAAAGAAGTTAAAAAAACTGTCTAATATAGAACTTAGTCCAAGTGAAGAAGAAAGGATAAAGAAAGATCTAAACGCTTTACTAGAGTATCAAAAAATATTAGACAAAATAGACGTTGAAGGAATTGAAGAGATGGTATCTCCCATTGAATTCTCGACTTCCATTTTAAGAAAAGACGAAGTAGAAAGCTTTGAAAGCAGAAAAAAAATAATAAACAACTTTCCAGAAAATAAAGATGGTTTTCTCGCAGTTCCTGGTATACATGTTAACGAGGAAGAATAA |
| Sequence | MEINTELIKKLKKLSNIELSPSEEERIKKDLNALLEYQKILDKIDVEGIEEMVSPIEFSTSILRKDEVESFESRKKIINNFPENKDGFLAVPGIHVNEEE |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
| Pubmed ID | |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | A9BFT2 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 756417 | 756719 | - | NC_010003.1 | Petrotoga mobilis SJ95 |
| 2 | 579862 | 580152 | - | NZ_LN824141.1 | Defluviitoga tunisiensis |
| 3 | 535429 | 535716 | - | NZ_AP018712.1 | Tepiditoga spiralis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_010003.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03486.16 | 0.67 | 2 | 2799.0 | same-strand | HI0933-like protein |
| 2 | PF00015.23 | 0.67 | 2 | 1914.5 | same-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
| 3 | PF19583.1 | 0.67 | 2 | 1144.5 | same-strand | ODP family beta lactamase |
| 4 | PF00753.29 | 0.67 | 2 | 1144.5 | same-strand | Metallo-beta-lactamase superfamily |
| 5 | PF02021.19 | 1.0 | 3 | 2 | same-strand | Uncharacterised protein family UPF0102 |
| 6 | PF09723.12 | 0.67 | 2 | 2609.0 | opposite-strand | Zinc ribbon domain |
++ More..